ID: 920009215

View in Genome Browser
Species Human (GRCh38)
Location 1:202855626-202855648
Sequence CTGTGGAGAAGTGGTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920009215_920009220 10 Left 920009215 1:202855626-202855648 CCTTGGGCACCACTTCTCCACAG 0: 1
1: 1
2: 2
3: 31
4: 219
Right 920009220 1:202855659-202855681 AGCAGGCCATGTACTTGCCGTGG No data
920009215_920009221 15 Left 920009215 1:202855626-202855648 CCTTGGGCACCACTTCTCCACAG 0: 1
1: 1
2: 2
3: 31
4: 219
Right 920009221 1:202855664-202855686 GCCATGTACTTGCCGTGGCGAGG No data
920009215_920009218 -7 Left 920009215 1:202855626-202855648 CCTTGGGCACCACTTCTCCACAG 0: 1
1: 1
2: 2
3: 31
4: 219
Right 920009218 1:202855642-202855664 TCCACAGTAGAGCAGGCAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 215
920009215_920009224 26 Left 920009215 1:202855626-202855648 CCTTGGGCACCACTTCTCCACAG 0: 1
1: 1
2: 2
3: 31
4: 219
Right 920009224 1:202855675-202855697 GCCGTGGCGAGGGTCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 81
920009215_920009223 16 Left 920009215 1:202855626-202855648 CCTTGGGCACCACTTCTCCACAG 0: 1
1: 1
2: 2
3: 31
4: 219
Right 920009223 1:202855665-202855687 CCATGTACTTGCCGTGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920009215 Original CRISPR CTGTGGAGAAGTGGTGCCCA AGG (reversed) Intergenic
900082023 1:865494-865516 CTGAGGGTAAGTGGTGCTCACGG + Intergenic
900425416 1:2576185-2576207 CTGTGGGAAAATGCTGCCCATGG - Intergenic
900503590 1:3018349-3018371 CCTGGGAGAAGTGGTGCCCTTGG - Intergenic
901059530 1:6465680-6465702 CCGGGCAGAAGGGGTGCCCATGG + Intronic
903130658 1:21277438-21277460 CTGTGCAGACGTGCTGGCCAGGG + Intronic
904255058 1:29249488-29249510 CTGTAGAGATGGGGTGCCCAAGG + Intronic
905226698 1:36483287-36483309 CTGTGAAGATGTGGTCCCCAAGG - Intergenic
911983564 1:104595811-104595833 CGGTGCATAATTGGTGCCCAAGG - Intergenic
912778065 1:112519035-112519057 CTGTGGAGCTGTGCTGTCCAGGG - Intronic
913664519 1:121035104-121035126 CTGTGGAGACGTGCTGCTCAGGG + Intergenic
914015913 1:143818382-143818404 CTGTGGAGACGTGCTGCTCAGGG + Intergenic
914161870 1:145142626-145142648 CTGTGGAGACGTGCTGCTCAGGG - Intergenic
914654530 1:149726923-149726945 CTGTGGAGACGTGCTGCTCAGGG + Intergenic
920009215 1:202855626-202855648 CTGTGGAGAAGTGGTGCCCAAGG - Intergenic
920300031 1:204982934-204982956 CTCTGGGAAAGTGGGGCCCAGGG - Intronic
920342932 1:205286914-205286936 CTTGGGACAAGTGGTGGCCAGGG - Intergenic
922875279 1:228935599-228935621 CTCTAGAGTAGTGGTCCCCAAGG + Intergenic
923009880 1:230080291-230080313 CTGTGGAGAAGGGGAGGCCTCGG + Intronic
924268646 1:242309156-242309178 ATGTAGAGCAGGGGTGCCCAAGG + Intronic
924862176 1:247936473-247936495 CCATGGCGATGTGGTGCCCACGG + Intergenic
1062916489 10:1244222-1244244 CTGTTGAGAAATGGTTCACAAGG + Intronic
1064192779 10:13222154-13222176 CTGTGGAGCAGTGGCGCCAGTGG - Exonic
1065311259 10:24417691-24417713 GTGGGAAGAAGTGGTACCCAAGG + Intronic
1066716260 10:38289612-38289634 ATGTAGAGCAGGGGTGCCCAAGG - Intergenic
1067027779 10:42859064-42859086 CTGGGGAGGAGGGCTGCCCAGGG - Intergenic
1067686845 10:48470865-48470887 CTGGGGAGAAGTGGTCCACTAGG + Intronic
1070785621 10:79160678-79160700 CCAGGGAGAAATGGTGCCCAGGG - Intronic
1072177312 10:92940382-92940404 GTCTTGGGAAGTGGTGCCCAAGG - Intronic
1075681802 10:124338716-124338738 GTGTGAAGGAGAGGTGCCCATGG - Intergenic
1075901378 10:126045138-126045160 CTGTGGGGATGGTGTGCCCAAGG - Intronic
1076811636 10:132889319-132889341 CTAGGGAGCAGAGGTGCCCATGG + Intronic
1079322304 11:19461275-19461297 CTGTGGAGGAGTGTTGGCAATGG - Intronic
1083342628 11:61968186-61968208 CGATGGAGAAGTGGGGCGCACGG + Intergenic
1083372084 11:62190195-62190217 CTGTGGAGCCGTGGAGCCCAGGG - Exonic
1084118964 11:67057778-67057800 CAGTGGTGAAGTGGAGCCCAGGG + Intronic
1084497225 11:69512254-69512276 CAGTGGAGAGATGGAGCCCAAGG + Intergenic
1086562087 11:88179273-88179295 CTGTGGAGAACAGGTTTCCATGG - Intergenic
1086859006 11:91902203-91902225 CTAAGGAAAAGTGGTGTCCATGG + Intergenic
1086947467 11:92857244-92857266 GTGTGGAGAAGCCGTGTCCAGGG + Exonic
1088598632 11:111457316-111457338 CTCTGGAGATGGGGGGCCCATGG + Intronic
1089589161 11:119529483-119529505 GGGTGGAGAGGTGGTGTCCACGG + Intergenic
1090027001 11:123176481-123176503 CTGTGGAGTAGTGGTGCCTGCGG - Intronic
1091385675 12:93188-93210 TTGTGGAGAACTGGTGCACCTGG + Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1095802687 12:46284571-46284593 CTTAGGAGAAGTGGTGCTCTGGG - Intergenic
1096764049 12:53868554-53868576 CTGTGGTGTAGTGGTTACCATGG - Intergenic
1097136923 12:56864761-56864783 CAGAGGAGCAGTGCTGCCCAAGG + Intergenic
1100815805 12:98386061-98386083 TTGTGGTGAAGTTGTGTCCAGGG - Intergenic
1101733482 12:107445489-107445511 ATGCTGAGGAGTGGTGCCCAGGG + Intronic
1103737636 12:123070601-123070623 CTGAGGAGCAGAGCTGCCCATGG + Intronic
1104771037 12:131364509-131364531 CTGTGCAGGAGGGCTGCCCACGG - Intergenic
1105214154 13:18274570-18274592 CGGTGGAGTAGTGGTGCCCCTGG + Intergenic
1106233439 13:27840813-27840835 ATATGGAGAAGGGGTCCCCAGGG - Intergenic
1107178154 13:37423473-37423495 GTCTGGAGCAGTGGTGGCCACGG + Intergenic
1107266482 13:38561738-38561760 CTGTAGAGATGTGCTGCCAAGGG + Intergenic
1108708992 13:53015133-53015155 CTGTGGAGAAGTGGTGCTGCAGG + Intergenic
1108856892 13:54803781-54803803 GTGTGGAGAAATGCTGGCCAAGG - Intergenic
1109169619 13:59079248-59079270 CTGAGGAGAAAAGGTGACCAAGG - Intergenic
1110058931 13:71016184-71016206 CAGTGGAAAAGTGATGCCCAAGG + Intergenic
1110573245 13:77028065-77028087 CTGAAAAGCAGTGGTGCCCAGGG + Intergenic
1116560910 14:46377316-46377338 CTGTGGGGAAGCCCTGCCCATGG + Intergenic
1118210684 14:63763317-63763339 CTGTAAAGAAGTAATGCCCATGG + Intergenic
1120186379 14:81397687-81397709 CTTTGGAGAACTTGTGCTCAGGG - Intronic
1121080285 14:91102555-91102577 CAGAGGAGCAGTGGTGTCCACGG + Intronic
1121265912 14:92602475-92602497 CTGTGGCCAAGTTGTGACCATGG - Intronic
1121861747 14:97325048-97325070 CTGGGTAAAAGTGGTGCCAAGGG + Intergenic
1123706698 15:22955803-22955825 GTGTGGAGAAGTGAGGTCCAGGG - Intronic
1125545065 15:40497442-40497464 CAGTGGAGAGGAGGGGCCCATGG - Intergenic
1125714749 15:41813148-41813170 CAGGGGAGAACTAGTGCCCAGGG + Intronic
1126152428 15:45535652-45535674 CTAAGGAGAAGGGGTTCCCAAGG - Intergenic
1132041060 15:98524967-98524989 CTCTGGGGCAGTGGTGCCCTGGG - Intergenic
1132303124 15:100788660-100788682 CTGGGGGGAGGTGATGCCCATGG + Intergenic
1132631223 16:918623-918645 CTGCGGGGACGTTGTGCCCACGG + Intronic
1132905849 16:2282617-2282639 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905873 16:2282691-2282713 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905897 16:2282765-2282787 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905920 16:2282839-2282861 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905943 16:2282913-2282935 CTGAGGAGAGGTGGTGCCCAGGG - Intronic
1132947713 16:2541195-2541217 CTGTCAAGAAGAGCTGCCCAAGG - Intronic
1132966726 16:2660148-2660170 CTGTTGAGAAGAGCTGCCCAAGG + Intergenic
1133232286 16:4372400-4372422 CTGTGCAGAAGGGCTGCCCGGGG + Intronic
1136269073 16:29137929-29137951 CTGCGGAGACGGGGGGCCCATGG + Intergenic
1137556557 16:49473980-49474002 GTGTGGAGCTGGGGTGCCCAGGG - Intergenic
1137808225 16:51327784-51327806 CTGTGGAGTAGAATTGCCCAGGG - Intergenic
1138628634 16:58274802-58274824 CAGTGCAGAAGTTTTGCCCAGGG - Intronic
1139588820 16:67921626-67921648 CTGAGGCCAAGTGGTTCCCAGGG - Intronic
1139664108 16:68444252-68444274 CTGTGGAGGAGAGCTGTCCAAGG - Intronic
1139810876 16:69616159-69616181 CTGTGTAGAAGGGTTGCCTACGG - Intronic
1141333956 16:83137718-83137740 CCGTGAAGGAGTGGGGCCCAGGG + Intronic
1141356549 16:83352069-83352091 TAGTGAAGAAGTGCTGCCCAGGG + Intronic
1142004445 16:87682803-87682825 TGTTGGGGAAGTGGTGCCCATGG + Intronic
1142117782 16:88369093-88369115 CTGTGGAGACCTGCCGCCCAGGG - Intergenic
1142366492 16:89652645-89652667 CTGTGGTGCTGTGGTGGCCAGGG - Intronic
1142412002 16:89921641-89921663 CTGGGGAGCAGTGGCGCCCCTGG + Intronic
1142421406 16:89972691-89972713 CTGTGGCGATGTGGTGGCCCAGG + Intergenic
1145937876 17:28725869-28725891 CTGTGGAAATGAGGTGGCCAGGG - Intronic
1145954104 17:28842732-28842754 CAGTGGAGAAGTGGTGGCGGCGG - Exonic
1146664931 17:34693262-34693284 CTGGTGAGAAGGGGAGCCCATGG - Intergenic
1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG + Intronic
1147334919 17:39721597-39721619 CTGTGGAGAAATGGTGGTCCAGG + Intronic
1151953052 17:77365806-77365828 CTGAGGCGACGTGGTCCCCAGGG - Intronic
1153054182 18:929302-929324 CTGTGAAGAAGAGGTTTCCACGG - Intergenic
1153347252 18:4040664-4040686 TTGTTGATAAGTGGTGCTCATGG + Intronic
1157901619 18:51523522-51523544 CTGTCAGGAAGTGGAGCCCAAGG - Intergenic
1162407815 19:10486246-10486268 CTCTGGAAATGTGGTTCCCAGGG - Exonic
1163923997 19:20321453-20321475 CTGTAGAGCAGTTTTGCCCATGG - Intergenic
1165310406 19:35026268-35026290 CTGTGCAGACGTGGGGACCACGG + Exonic
1166852069 19:45765861-45765883 CTGTGCAGAAAGGGTGCCTAGGG + Exonic
1167745964 19:51352043-51352065 CTGAGCAGAGGTGGTGCCCGAGG + Intronic
1168073130 19:53963519-53963541 CAGAGGAGGAGGGGTGCCCAAGG - Intronic
924989597 2:301095-301117 CTGTGGACAAATGGTGCTGATGG - Intergenic
926231874 2:11010459-11010481 GTGTGGAGTAGTGGTGGGCAGGG + Intergenic
926694152 2:15758933-15758955 GTGTGGCCAAGTGGTGACCAAGG + Intergenic
928370101 2:30734414-30734436 CTTTGGAGCTGTGGTGCCCAAGG - Intronic
929165312 2:38875816-38875838 CTGTCGGGAGGTGCTGCCCAAGG + Exonic
930116532 2:47723057-47723079 CTGTAGAGAAGTGGGGCCTTGGG + Intronic
930972760 2:57417296-57417318 CTCTGGGGAAGTGGTTCTCAGGG - Intergenic
932584729 2:73020544-73020566 GTGTGGAGTGGTGGTGCCCCAGG - Intronic
934300166 2:91772180-91772202 CGGTGGAGTAGTGGTGCCCCTGG - Intergenic
935162343 2:100540202-100540224 CTGGAGAGAACTTGTGCCCAAGG + Intergenic
935338918 2:102042514-102042536 GAGGGGAGAAGTGGTGTCCAGGG + Intergenic
936456050 2:112675171-112675193 ATGTGGAAAAGTGATCCCCAAGG + Intergenic
937633846 2:124133586-124133608 CTGTGGAGAGGTGTTGGCAAAGG - Intronic
939580222 2:143937829-143937851 CTCTGGATAGGTGGTGCCCGGGG + Intergenic
940150432 2:150594539-150594561 CTGTGGATGAGCGTTGCCCATGG + Intergenic
946366218 2:219250720-219250742 CCGTGGAGATGTGGTGCCCAAGG - Exonic
946369451 2:219271746-219271768 CCATGGAGATGTGGTGCCCAAGG + Intronic
947740049 2:232480853-232480875 CAGAGAAGAAGCGGTGCCCAGGG - Intronic
948654690 2:239469335-239469357 CTCTAGAGAAGTGATCCCCAGGG + Intergenic
1169726620 20:8740891-8740913 CTGGGGAGTAGTGGAGACCATGG + Intronic
1170736666 20:19018889-19018911 TTTTGGAGAGGTGCTGCCCAGGG - Intergenic
1172627018 20:36353140-36353162 ATGGGGAGAAGGGGTGGCCAGGG + Intronic
1172875763 20:38163571-38163593 CTGTAGTGAGGTGGTTCCCAGGG - Intronic
1175760946 20:61561986-61562008 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175760961 20:61562034-61562056 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175760977 20:61562082-61562104 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175760992 20:61562126-61562148 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175761008 20:61562174-61562196 CTGTGGAGAGGTGGACCCCAGGG + Intronic
1175761021 20:61562222-61562244 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175761036 20:61562268-61562290 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175761050 20:61562316-61562338 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175761065 20:61562364-61562386 GTGTGGAGAGGTGGACCCCAGGG + Intronic
1175785958 20:61711996-61712018 CTGTGCAGGAGGGGTCCCCAGGG + Intronic
1176742265 21:10615734-10615756 CTGGTGAGAAGTGGTGGCCAGGG + Intergenic
1178352088 21:31879535-31879557 CAGTGCAGAAACGGTGCCCACGG + Intronic
1180077295 21:45469189-45469211 CTGTGGTGAAGTGGGGCTCCCGG + Intronic
1180564136 22:16648951-16648973 CTGGTGAGAGGTGGTGGCCAGGG + Intergenic
1180751402 22:18126935-18126957 CCGGGGCGACGTGGTGCCCAAGG + Exonic
1180866363 22:19122194-19122216 CGGAGGATAAATGGTGCCCAAGG - Exonic
1181514884 22:23404751-23404773 CTGTGGGGAAGTGGAGGCCCAGG - Intergenic
1181555855 22:23671343-23671365 CGGTGGAGTAGTGGTGCCCCTGG + Intergenic
1181698522 22:24607310-24607332 CGGTGGAGTAGTGGTGCCCCTGG - Intronic
1182974292 22:34608213-34608235 CTGTGGGAAAGAGGTGCCGATGG - Intergenic
950075994 3:10187791-10187813 CTCTGGGGAAATGGTGACCATGG + Intronic
950930349 3:16783204-16783226 GTGAGGAGAAGTAGTTCCCAGGG + Intergenic
951184588 3:19698055-19698077 CTGTGGAATAGTGGTTTCCAGGG + Intergenic
956700785 3:71956760-71956782 CAGTGGATAAGTGCTGGCCAAGG + Intergenic
958829647 3:99072155-99072177 CTGTGGAAAAGTGGTAGGCAGGG - Intergenic
958833229 3:99114851-99114873 CTGTGTAGAAATGGTCGCCAGGG + Intergenic
959257186 3:104030803-104030825 CAGTGGAAATGTGGTACCCAGGG - Intergenic
960002518 3:112748149-112748171 CTGGGGAGATTTGGTGACCAGGG + Intronic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
962751695 3:138438469-138438491 CTGTGAAGGAGTGGAGGCCAAGG + Intronic
962990398 3:140572601-140572623 CTGAGGAGCAGTGGTTCCCTGGG + Exonic
964389751 3:156184864-156184886 CTGTGGAGCACAGGAGCCCAGGG - Intronic
966830327 3:184002623-184002645 AGCTGGAGAAGTGGTGGCCATGG - Intronic
969704456 4:8784333-8784355 CGGTGGAGAGGTGGGGCCAAGGG + Intergenic
975616516 4:76252254-76252276 CTGTGGCCAAGTGGAGCCCAGGG + Intronic
975987808 4:80219666-80219688 CTGAGGAGTAGAGGAGCCCATGG - Intergenic
976931221 4:90569533-90569555 CAGTGGGCATGTGGTGCCCAAGG - Intronic
981658417 4:147138394-147138416 CTGGGGAGAAGATGTCCCCAGGG + Intergenic
982411782 4:155085928-155085950 CCATGGAGAAGAGGTCCCCATGG - Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983479934 4:168260532-168260554 CGGTGGGGAAGTGGTGCACAAGG + Intronic
985271139 4:188196382-188196404 CCGTGCAGAAGTGGAGCTCAAGG - Intergenic
985356454 4:189124900-189124922 CTGTGGAAAAGCTGTGCCTATGG + Intergenic
985500238 5:239121-239143 CTGTGGAGAGGTGGTGGGCGGGG + Intronic
985737158 5:1590569-1590591 CTGTGGAGAGGTGGTGGGCGGGG - Intergenic
985789262 5:1916448-1916470 CTGTGGAGACGTGGGGCTGAAGG - Intergenic
987927423 5:24361025-24361047 CTGTCGAGATGTGGGGCACAAGG + Intergenic
988525648 5:31984862-31984884 CTGCTGAGAAATGGTGCCCTGGG + Intronic
995256017 5:110047854-110047876 CTCTTGGGAAGTGGTGTCCAAGG - Intergenic
997574455 5:134963303-134963325 CTGTGGACATGTGGTGTGCAGGG + Intronic
997732288 5:136190581-136190603 CTGAGGAGAAGTGGTGGGCTGGG + Intergenic
997772139 5:136565113-136565135 CTGTGGAGAAGAGGGGACAATGG - Intergenic
998186362 5:139982818-139982840 CTGAGGAGTAGTCTTGCCCAGGG + Intronic
999901355 5:156089902-156089924 CTGTGGAAAACTGATGCCTATGG - Intronic
1001101940 5:168821459-168821481 CTGGGGAAAAGTGGGACCCAGGG - Intronic
1001667837 5:173448104-173448126 CTGTGGACAAGGGGTGGTCAAGG - Intergenic
1002516588 5:179763664-179763686 CTGTTGAGAACTGATGCCCGTGG + Intronic
1002669668 5:180856495-180856517 CTGAGGCTAAGTGTTGCCCAAGG + Intronic
1003595186 6:7468425-7468447 CTGTGGCGCAATGGGGCCCAAGG - Intergenic
1005733949 6:28727519-28727541 ATGTGGAGAATTGGAACCCAAGG + Intergenic
1006109041 6:31733928-31733950 CAGTGCAGAAGCTGTGCCCAGGG - Exonic
1008065304 6:47041399-47041421 GTGTGGAGAAGTGATGACCTTGG - Intronic
1009674303 6:66797018-66797040 GTGTGAAAAAGGGGTGCCCATGG + Intergenic
1010350976 6:74873993-74874015 CTGTAGTGAAGTGGGGCCCAGGG + Intergenic
1010398956 6:75426726-75426748 CTCTGTTGAAGTAGTGCCCATGG - Intronic
1010794927 6:80107157-80107179 GGGTGGAGGGGTGGTGCCCAGGG + Intronic
1014747976 6:125222285-125222307 CTGTGGAGAATTGGGGCAGAGGG - Intronic
1016188405 6:141227374-141227396 ATGAGTAGAAGTGGTGACCATGG - Intergenic
1018144027 6:160866104-160866126 CTTGGGAGAAGTGGTGGCGATGG + Intergenic
1019647067 7:2136613-2136635 CTGTGGAGAACAGGAGCCCCTGG - Intronic
1019687831 7:2391520-2391542 CTGTGCACAACTGGGGCCCATGG - Intergenic
1020419118 7:7980295-7980317 CTGAGGAGAAGTGGGTGCCATGG + Intronic
1022317649 7:29260519-29260541 ATCTGGAGAAGGGGTGGCCATGG + Intronic
1022645316 7:32224043-32224065 TTGTAGAGAACTGGTGCCAAGGG - Intronic
1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG + Intergenic
1026848317 7:73709805-73709827 CTGGGGTTTAGTGGTGCCCAGGG - Intronic
1033206576 7:139428292-139428314 CTGGGGTGCAGTGGTGCACATGG + Intergenic
1035294803 7:157861018-157861040 CTGTGGAGAGGTGGGGGGCAGGG + Intronic
1035470955 7:159108332-159108354 CTGTGGACAGATGGTCCCCATGG - Intronic
1035523245 8:292060-292082 CTGAGGGCAAGTGGTGCTCACGG - Intergenic
1038078436 8:24104122-24104144 CTGTGGAGATCTGATGGCCAGGG + Intergenic
1038935437 8:32244788-32244810 CTGTTGAGAAGTAGTGGCAAAGG + Intronic
1039720040 8:40153598-40153620 CTGTGTCGAAGTGGTAGCCATGG - Exonic
1042112157 8:65392118-65392140 CTGTGGAGCAGTGGGTCTCAAGG + Intergenic
1043312691 8:78880847-78880869 CTGTGGAGATCTGGTACTCAAGG + Intergenic
1044186973 8:89264929-89264951 ATTTGGAGGAGTGGTTCCCATGG - Intergenic
1045860546 8:106811253-106811275 CTGTGGAGAAATGGGGCACAGGG + Intergenic
1047214997 8:122869128-122869150 CTGTGGAGAAGTTCTGCTCTAGG - Intronic
1048547935 8:135404595-135404617 CTGTGGAGAGGAGCTACCCATGG - Intergenic
1050145251 9:2560391-2560413 GTCTGGAGCAGTGGTGGCCATGG + Intergenic
1053540145 9:38965255-38965277 GTGTGGAGAAGAGGGGCACATGG - Intergenic
1054856835 9:69909443-69909465 CTCTGGAGCACTGGTGTCCATGG - Intergenic
1055615897 9:78072642-78072664 CTGTGGAAACCTGGTGCCTATGG - Intergenic
1056078367 9:83063352-83063374 CTGTGGAGAAGCGGAGCGCTGGG - Intergenic
1058834853 9:108851978-108852000 CTGAGGAGGGGTGGTGCCCGTGG - Intergenic
1060508669 9:124216691-124216713 CTGTGGGGAAGGGGTGCACAGGG + Intergenic
1060618703 9:125043811-125043833 CAGTGGGGAAGTTGTGGCCAGGG + Intronic
1060793722 9:126501558-126501580 CTGTGGAGCAGTGGCAGCCATGG + Intronic
1061003271 9:127914721-127914743 CTGTGGGGAAGTGGTGGTCCAGG + Exonic
1061514910 9:131083460-131083482 CTGTGGAGCAGTCTTCCCCAGGG + Intronic
1061752809 9:132792573-132792595 CCCTGGAGAGGGGGTGCCCAGGG + Intronic
1061757463 9:132825003-132825025 CAGTGGAGGAATGGTACCCATGG - Intronic
1061904839 9:133691299-133691321 CTGAGGCCAACTGGTGCCCAGGG + Intronic
1062027318 9:134346566-134346588 CTGGGGACTAGGGGTGCCCAGGG + Intronic
1062504056 9:136863966-136863988 CTAAGGACTAGTGGTGCCCAAGG + Intronic
1186937659 X:14468335-14468357 TTGTGGAAAAATGTTGCCCATGG + Intergenic
1189059382 X:37736753-37736775 CTCTGGAGAACTGGTTCCGAAGG + Intronic
1193075997 X:77356287-77356309 CTGAGGAGATCTGGTGCCCGAGG + Intergenic
1193442889 X:81565069-81565091 CTGTGGTGCAGTGGTGCACTGGG - Intergenic
1194339165 X:92688309-92688331 CTGTCAAGAAGTGGAGCCTAGGG + Intergenic
1194505645 X:94730253-94730275 ATGTGGAGCAGTGGGGCCCTGGG + Intergenic
1198130854 X:133693801-133693823 ATGTGGAGGTGTGGTCCCCAAGG + Intronic
1199118046 X:144015786-144015808 CTGACTAGAAGTGGAGCCCATGG - Intergenic
1200077549 X:153558911-153558933 CTGTTGAGAAAGGGTTCCCATGG - Intronic
1200647556 Y:5805090-5805112 CTGTCAAGAAGTGGAGCCTAGGG + Intergenic
1200911899 Y:8538461-8538483 CTCTGGCTAAGTGGTGGCCAAGG + Intergenic
1201543994 Y:15140523-15140545 CTGTGGAGAAGAGGTGGGAATGG + Intergenic
1201624454 Y:15998803-15998825 CTGGGGAGAGGTGATCCCCAAGG - Intergenic
1202037037 Y:20646256-20646278 CTGTGGCTAAGTGGTGGCCAAGG + Intergenic
1202152379 Y:21855333-21855355 CTCTGGCTAAGTGGTGGCCAAGG - Intergenic
1202600586 Y:26589918-26589940 CTGGTGAGAGGTGGTGGCCAGGG + Intergenic