ID: 920014857

View in Genome Browser
Species Human (GRCh38)
Location 1:202898595-202898617
Sequence CTAGTTTACAGGCAATACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920014850_920014857 21 Left 920014850 1:202898551-202898573 CCAAAAAACTGAGCCTGACTCTT 0: 1
1: 0
2: 0
3: 20
4: 186
Right 920014857 1:202898595-202898617 CTAGTTTACAGGCAATACATGGG 0: 1
1: 0
2: 3
3: 34
4: 174
920014852_920014857 -8 Left 920014852 1:202898580-202898602 CCTCTAATCCAACCACTAGTTTA 0: 1
1: 0
2: 1
3: 12
4: 114
Right 920014857 1:202898595-202898617 CTAGTTTACAGGCAATACATGGG 0: 1
1: 0
2: 3
3: 34
4: 174
920014851_920014857 8 Left 920014851 1:202898564-202898586 CCTGACTCTTAACAAGCCTCTAA 0: 1
1: 0
2: 0
3: 19
4: 188
Right 920014857 1:202898595-202898617 CTAGTTTACAGGCAATACATGGG 0: 1
1: 0
2: 3
3: 34
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920014857 Original CRISPR CTAGTTTACAGGCAATACAT GGG Intronic
902449441 1:16487329-16487351 CCAATTTACAGGAAATACATGGG + Intergenic
902469084 1:16635914-16635936 CCAATTTACAGGAAATACATGGG + Intergenic
902505041 1:16933987-16934009 CCAATTTACAGGAAATACATGGG - Intronic
904668081 1:32139541-32139563 CCATTTTACAGGAAATACAAGGG + Intronic
905039230 1:34940284-34940306 CAAGTTTACAGGAAATATAGGGG - Intergenic
905749850 1:40452453-40452475 CTGGTTTACAGAAAATACAGGGG + Intronic
908884844 1:68777260-68777282 CTTATTTACAGGAAATACAGGGG - Intergenic
910250591 1:85194367-85194389 ATAATTTATAGGCAATATATAGG - Intronic
914390413 1:147216714-147216736 CTAGTCTACAGACCATACTTTGG - Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916258358 1:162813964-162813986 TTAGATTTCAGGCATTACATTGG - Intergenic
916544581 1:165791370-165791392 CTAGTTTTCAGGAAATACAGAGG + Intronic
917321864 1:173790960-173790982 CCAGTTTACAGGAAATACAAAGG + Intergenic
920014857 1:202898595-202898617 CTAGTTTACAGGCAATACATGGG + Intronic
920396816 1:205652635-205652657 CCAGTTTACAGAAAATACAGGGG + Intergenic
923579536 1:235195020-235195042 GTAGTTTCCAGGAAATATATCGG - Intronic
1064796210 10:19014353-19014375 CTAATTTTCTGACAATACATTGG - Intergenic
1065498828 10:26358072-26358094 CCATTTTACAGCCATTACATTGG + Intergenic
1066358527 10:34708131-34708153 CTTCTTTACAGGAAATACAGGGG + Intronic
1066724801 10:38379648-38379670 TTAGATTTCAGGCATTACATTGG - Intergenic
1068373063 10:56144406-56144428 CTAGTTTACAGTCAAAGCAATGG - Intergenic
1069393930 10:67967774-67967796 TTAGTTTATAGGAAATACAAGGG + Intronic
1071466306 10:85942762-85942784 CCAGTATTCAGGCAACACATAGG - Intronic
1071516744 10:86302637-86302659 CCAGCTTGCAGGCAATACAGGGG + Intronic
1071697309 10:87890155-87890177 TTAATTTGCAGGAAATACATAGG - Intronic
1073374882 10:103024883-103024905 CCAGTGTACAGGAAATACATGGG - Intronic
1073409930 10:103332108-103332130 CTAATTTACAAGAAATACAGGGG - Intronic
1073741403 10:106411729-106411751 CTAGTTTATAGGGAACACTTAGG - Intergenic
1074093084 10:110281750-110281772 CCAGTTTACAGTCAATATAAAGG - Intronic
1074290492 10:112134701-112134723 CTAGGTTACAGGAAATACGGGGG + Intergenic
1074316053 10:112362711-112362733 ATAGTTTTCAAGCATTACATGGG + Intergenic
1075992281 10:126848241-126848263 ATAATTAACAGGCAAAACATAGG - Intergenic
1076276743 10:129205934-129205956 CTATTTTACAAGCAAACCATTGG - Intergenic
1078635349 11:13044524-13044546 CTAGTTGACAGGAATTACAGGGG + Intergenic
1079722179 11:23830406-23830428 CTAGTAGACAGGAAATATATAGG + Intergenic
1079948736 11:26775379-26775401 ATAGTTTACAAGCAATATAAAGG - Intergenic
1080587608 11:33695716-33695738 CTAGTTTACAGTAAAGAGATTGG - Intergenic
1084476455 11:69392191-69392213 CCAGTTTCCAGGCAATCCACTGG - Intergenic
1085566488 11:77519384-77519406 CTAGTTTACATGAAATACAGGGG - Intronic
1085680866 11:78574110-78574132 CAAGTTTACAGGTAATACCCTGG + Intronic
1090179258 11:124680339-124680361 CCAGTTTACAGGAAATTCAAAGG + Intronic
1091592049 12:1848377-1848399 CCAGTTGACAGGCAATGCAGGGG - Intronic
1092113365 12:5980388-5980410 CTAGTCTACTGGAAATACAGGGG + Intronic
1092701174 12:11232491-11232513 CCAGTTTCCAGGAAATACAGGGG + Intergenic
1092791644 12:12075887-12075909 TCAGTTTACAGGAAATACAGGGG - Intronic
1093013549 12:14133467-14133489 TCAGTTTACAGGCAATACAGAGG - Intergenic
1095220812 12:39612188-39612210 CTAGATTACAGGCTATGCATAGG - Intronic
1096014485 12:48256905-48256927 CCAATTTACAGAAAATACATGGG - Intergenic
1101082117 12:101197493-101197515 CCAGTTTACAAGAAATACAGAGG + Intronic
1104407375 12:128529320-128529342 CTAGTTTAAAGGAAATGCAAAGG + Intronic
1105531110 13:21221396-21221418 CTAGTTTTCAGGAAATACAGAGG + Intergenic
1106211427 13:27651162-27651184 CTAGTTTGCAAGAAATACAGAGG + Intronic
1106265520 13:28106146-28106168 CCAATTTATAGGAAATACATGGG + Intergenic
1108645618 13:52424486-52424508 CCAGTTTATAGGAAATACATAGG + Intronic
1109726286 13:66345637-66345659 TTAGTTTACAGGAAATTCAGGGG - Intronic
1109940078 13:69350328-69350350 CTAATTTACAGGAAAGACAAAGG + Intergenic
1112569934 13:100585072-100585094 CTAGTTTACAGGAAATATAGGGG + Intronic
1113286748 13:108858095-108858117 CTAGTCCACAGACAACACATTGG - Intronic
1115622576 14:35154578-35154600 CTAATTTACTGGAAATACAGGGG + Intronic
1116244717 14:42394821-42394843 ATAGATTAGAGGCAATTCATGGG - Intergenic
1117349051 14:54862815-54862837 CTAGTTTATAGGAAATCCAGAGG + Intronic
1117349246 14:54864716-54864738 CTAGTTTACAGGAAATCCAGAGG - Intronic
1117400425 14:55354294-55354316 CCAGTTTACAGCAAATACAAGGG - Intronic
1117864945 14:60137340-60137362 CTAGTTAACTGACCATACATTGG + Exonic
1119458823 14:74780865-74780887 GTAGTTTACAGGCAAAACACAGG - Intronic
1121302058 14:92879928-92879950 CCAGTTTGCAGGAAATACAAGGG - Intergenic
1124452530 15:29809314-29809336 CCAATTTACAGGAAATACAGTGG + Intronic
1124702729 15:31930758-31930780 CCAGTTTATAGGAAATACAAGGG - Intergenic
1127976870 15:64004250-64004272 CTCATTTACAGGAAATACAGGGG - Intronic
1128096723 15:64961934-64961956 CCAGTTTACAGGAAATACCAGGG + Intergenic
1128361824 15:66967400-66967422 CCAGTTTCCAGGAAATACAGAGG - Intergenic
1128629635 15:69251172-69251194 CTGGTTAACAGGAAATACAAGGG - Intronic
1128934184 15:71731487-71731509 CTAGTTTCCAGGCCAGACAAGGG + Intronic
1129860686 15:78858729-78858751 CCAGTTTACAGGAAATATAAAGG - Intronic
1131707334 15:95012202-95012224 CTAGTTTATAGGAAATACCAGGG + Intergenic
1137338745 16:47576857-47576879 CTTTTTTATAGACAATACATAGG + Intronic
1138755359 16:59477657-59477679 CCAGTTTACCCCCAATACATAGG - Intergenic
1143475068 17:7197852-7197874 CCAGTTTACAGGAGATACAGGGG - Intronic
1143698947 17:8642992-8643014 CTAATTTACAGAAAATACAGAGG + Intergenic
1143820450 17:9557293-9557315 CAAGATTACAGGCAATATTTTGG + Intronic
1144772633 17:17768536-17768558 CCAGTTTACACGCCAGACATAGG + Intronic
1146369000 17:32252812-32252834 CCAATTCACAGGAAATACATTGG - Intronic
1146689498 17:34863437-34863459 CTAGCTTACAGAGGATACATGGG + Intergenic
1147340221 17:39749063-39749085 CTAGTTTACGGGAAATACAAGGG + Intergenic
1149634601 17:58156720-58156742 CAAGTTTAGAGGCAAGAAATAGG + Intergenic
1151949919 17:77345872-77345894 AGAGTTAAGAGGCAATACATGGG + Intronic
1153853348 18:9118431-9118453 CTAGTATAAAGGCAATATAGTGG + Intronic
1156283162 18:35661724-35661746 CTAATTTACAGGAAATATACGGG - Intronic
1159093372 18:63874069-63874091 CTAGTTTATAGGAAATGCAAGGG - Intronic
1159258823 18:65983712-65983734 CTACTGTACAGGCAATCTATTGG + Intergenic
1159628572 18:70723068-70723090 CTCCTTTACAGGCACTACATGGG - Intergenic
1159764516 18:72471700-72471722 CTAATTTACAAGCACTACACAGG + Intergenic
1160041329 18:75348367-75348389 ATAGTTTACAGAAAATACAAGGG - Intergenic
1165499528 19:36177001-36177023 CTAATTTACAGGAAATACTAGGG + Intergenic
1165721082 19:38080305-38080327 CCAGTTCACAGGAAATACAGGGG + Intronic
1166962531 19:46507260-46507282 CCAGTTGCCAGGAAATACATTGG - Intronic
1168597744 19:57692762-57692784 CTAGTATACAGGAAATACTGGGG - Intronic
925548972 2:5049621-5049643 CTAGATTGCAAGCAAGACATTGG + Intergenic
928631030 2:33192415-33192437 CAAGTTTACAGGGAATACCAAGG + Intronic
929629174 2:43441722-43441744 CTAGATTACAGACCTTACATGGG - Intronic
931089111 2:58866705-58866727 CTGGTTTACAGGTAAAACAGGGG - Intergenic
931423745 2:62151971-62151993 CTGGTTTACAGGAAATACTGGGG - Intergenic
932601069 2:73126054-73126076 TAAGTTTACAGGAAATATATGGG + Intronic
934050663 2:88207829-88207851 CTAGTTTACAGGGAATACAGAGG + Intergenic
940013913 2:149083608-149083630 CCAGTTTACAGGAAATACAAAGG - Intronic
940526403 2:154820343-154820365 CTAATTTTCAGGAAATACAATGG - Intronic
940939655 2:159544117-159544139 CTAATTTACAGGAAATAAAAAGG - Intronic
942117488 2:172742442-172742464 CTAATTTACAGGAAATACAGGGG - Intronic
942266374 2:174230616-174230638 CTAGTTTACAGGAAATATAGAGG + Intronic
943504268 2:188733614-188733636 ATAGTTAACAGCCAATACATAGG - Intergenic
946103937 2:217352827-217352849 CTATTTTACAGGGAAAACAGAGG + Intronic
946492059 2:220158099-220158121 CTAGTTCCCAGGCAAAACAAGGG + Intergenic
946663961 2:222030152-222030174 TTATTGTACAGGCAATTCATAGG - Intergenic
1170973426 20:21138341-21138363 CCAGTTCACAGGAAATACAGGGG - Intronic
1172923347 20:38506708-38506730 CCAGTTTATAGGAAATACAGCGG - Intronic
1174225088 20:48991945-48991967 CCAGTTTACAGGAAATACAGTGG + Intronic
1174499589 20:50974979-50975001 CCAGTTTATAGGAAATACAGAGG - Intergenic
1175655349 20:60765114-60765136 CCAGTTTGCAGGAAATACAGGGG + Intergenic
1178940062 21:36898100-36898122 CTAGTTTGCAGATAATACAGAGG + Intronic
1179611159 21:42551968-42551990 CCAGTTTACAGGAGATACAGGGG - Intronic
1179776499 21:43666987-43667009 TTAGTTTATAGGAAATACAGGGG - Intronic
950064218 3:10098629-10098651 TGAGTTTACAGGCAATACAAAGG - Intronic
950617137 3:14169333-14169355 TTAGTTTACAAGAAATACAGGGG + Intronic
950879038 3:16306714-16306736 CCAGTTTACATGAAATACAGAGG - Intronic
951752281 3:26050345-26050367 TTAGTTTACTGGTTATACATTGG + Intergenic
952200483 3:31121642-31121664 GTAGTTTACAGGAAGTACAGGGG - Intergenic
953695820 3:45158081-45158103 CCAGCTTACAGGAAATACAGAGG - Intergenic
954743426 3:52772759-52772781 CTAGGTTGTAGGAAATACATAGG + Intergenic
956286579 3:67616483-67616505 CAAGTTTACTGGCAATAGCTTGG - Intronic
960690053 3:120337124-120337146 CCAGTTCACAGGCAATTCAAGGG - Intronic
961704809 3:128775715-128775737 CTACTTAACAGGCATTTCATGGG - Intronic
963034652 3:141015155-141015177 CCACTTTACAGGAAATACAGGGG + Intergenic
963184535 3:142398730-142398752 CTAGCTTACAGGAAATATGTGGG + Intronic
963528929 3:146448746-146448768 TCAATTTACAGGAAATACATGGG - Intronic
964780510 3:160332069-160332091 CTAATTTACAGGAAATAAAGGGG - Intronic
967908613 3:194522747-194522769 CTAGTTTACAGGAAATGCCAAGG + Intergenic
969205784 4:5644186-5644208 TTAGTTTACAGGAAATACAGAGG - Intronic
972140849 4:35957740-35957762 CTAGTATACTGGCAATACCTTGG - Intronic
972587990 4:40456190-40456212 TTAGTTAACAGGCAATATTTAGG - Intronic
972824847 4:42745782-42745804 CTAGGTTACAGGAAATACAGGGG + Intergenic
974109334 4:57508785-57508807 CAAGTTTACAAGCAGAACATGGG + Intergenic
975112520 4:70643265-70643287 ATACCTTAGAGGCAATACATGGG + Exonic
976278519 4:83303193-83303215 CCAGTTTACAGGAAACACAGGGG + Intronic
976320845 4:83713487-83713509 CGAGTTTCAAGGTAATACATAGG - Intergenic
981296510 4:143139338-143139360 CTACTTTACAGGCAATGAAATGG - Intergenic
986040256 5:3987308-3987330 CTGGTGTTCTGGCAATACATTGG - Intergenic
986106291 5:4662495-4662517 CTAGTTTAAAGGAACTAAATTGG + Intergenic
986695025 5:10344110-10344132 CTAGTTTATAGGAAATACAGGGG + Intergenic
987213177 5:15705728-15705750 CTACATTCCAGGCAATATATTGG + Intronic
988078476 5:26383679-26383701 ATACTTTACAGCTAATACATAGG - Intergenic
989033613 5:37145948-37145970 CTAATTTACAAGAAATACAGAGG + Intronic
989372937 5:40728817-40728839 CTAGTTTAATGGCAATACCTGGG - Intronic
989798329 5:45503273-45503295 CTAGTTTATAGGAAATAAAGGGG + Intronic
990934711 5:61135708-61135730 CCAGTTTACATGAAATACAAGGG + Intronic
994502931 5:100602979-100603001 CTTTTTTAAAGGCAATACATTGG - Intergenic
994765487 5:103910965-103910987 CAAATTTACAGGAAATACAGAGG + Intergenic
995409405 5:111838003-111838025 CTAGATTACAGAAAATACAGGGG + Intronic
995741739 5:115363212-115363234 CCAGTTTATATGAAATACATGGG - Intergenic
995765923 5:115618587-115618609 CCAGTTTACAAGAAATACAGAGG - Intronic
997652772 5:135534921-135534943 CTAGTCAGCAGGCAATAGATGGG - Exonic
998838437 5:146227352-146227374 CTAATTCACAGGAAATACAGAGG - Intronic
998840405 5:146247648-146247670 CAAATTTACAGGTAATACAGGGG - Intronic
999290705 5:150423837-150423859 CCAGTTTAGAGTCAATACAGGGG + Intergenic
1000872895 5:166599441-166599463 CTATTATAAAGGCAATAAATGGG - Intergenic
1001660969 5:173392974-173392996 CTAGGTTACAGGAAATACTGAGG - Intergenic
1002333119 5:178458898-178458920 CCAGTTTACAGGAAATACAGGGG + Intronic
1003391551 6:5717531-5717553 CTAGTTTTCAGGCAATACAGAGG - Intronic
1006918716 6:37613734-37613756 TTAGTTTACAGGCAAGAAAATGG + Intergenic
1010710286 6:79166019-79166041 CTAGTATTCAGGAAACACATAGG + Intergenic
1015243071 6:131047775-131047797 GTAGTTTAGAGGCAATATGTTGG - Intronic
1017548120 6:155473260-155473282 ATAGTCCATAGGCAATACATAGG + Intergenic
1017864734 6:158433255-158433277 CCAGTTTATAGGAAATACAAGGG - Intronic
1018389941 6:163334531-163334553 CCAGTTTACAGGCAATGCAGGGG + Intergenic
1020478624 7:8629632-8629654 CTACTTTACAGACAATACTATGG - Intronic
1021050101 7:15972574-15972596 AGAGTTTTCAGGAAATACATAGG - Intergenic
1021250501 7:18319623-18319645 CTAAATTACAAGCAATATATTGG - Intronic
1021739909 7:23676538-23676560 CAAATTTACAGGAAATACAGGGG + Intergenic
1021880974 7:25095083-25095105 ACAGTTTACAGGAAATACAGGGG - Intergenic
1022231155 7:28413612-28413634 CTAATTGACAGGCAATTTATCGG - Intronic
1022390422 7:29938963-29938985 CTAATTTACAGAAAATACAGAGG - Intronic
1027364017 7:77438388-77438410 CTAGTTTGCAGGAAATACTGGGG + Intergenic
1027694409 7:81391328-81391350 CTATTTAATAGGCAATACAATGG - Intergenic
1031793111 7:126135278-126135300 CTGGTTTACTGGCCACACATGGG - Intergenic
1036067841 8:5403282-5403304 ATTGTTTTCAGGCAAGACATTGG + Intergenic
1036106214 8:5843498-5843520 CTTGTTTACAATCTATACATTGG + Intergenic
1037915344 8:22769554-22769576 CTAGGCTGCAGGCAAGACATGGG - Intronic
1038615875 8:29094224-29094246 CCAGTTCACAGGCAATACAGGGG + Intronic
1042319291 8:67457976-67457998 CTACTTGTCAGGCAATACAATGG + Intronic
1043460512 8:80455595-80455617 CTAGGTTACAGGAAATACAGGGG - Intergenic
1045805576 8:106157092-106157114 CTAGTAGATAGGCAATACACAGG - Intergenic
1045895304 8:107209265-107209287 CTAGTTTATAGTCATTACATGGG - Intergenic
1047108918 8:121766949-121766971 CTATTGTACAGAGAATACATTGG - Intergenic
1048744360 8:137597338-137597360 TCAGTTTACAGGAAATACAAGGG - Intergenic
1050899882 9:10933762-10933784 CCTGTCTACAGGCAAGACATCGG - Intergenic
1052161124 9:25261225-25261247 TTTGTTTACAGGCAATAAAAAGG - Intergenic
1055000008 9:71438061-71438083 CTAGTTCATAGGAAATACAATGG + Intronic
1055284505 9:74714032-74714054 CTAGTTCATAGGGCATACATTGG - Intergenic
1056963184 9:91144549-91144571 TCAGTTTACAAGCAATACAGGGG - Intergenic
1058028117 9:100165027-100165049 CTAATTTACAGGAAATACATAGG - Intronic
1058198177 9:102004743-102004765 TTAGTTTGCAGGAAATACAGAGG - Intergenic
1059718490 9:116935918-116935940 CTATTTTACAGGTGAGACATTGG + Intronic
1060157926 9:121332942-121332964 CTAGTTTACAGGCAAATGCTAGG - Intergenic
1186199086 X:7138121-7138143 CTAGATTAGAGGAAATACAGGGG + Intronic
1187196111 X:17086171-17086193 TTAGTTTATAGGAAATACATGGG - Intronic
1187892594 X:23950492-23950514 CCAATTTACAGGAAATACAGAGG - Intergenic
1189314778 X:40047197-40047219 CCAGTTTACAAGAAATACAAGGG - Intergenic
1189780833 X:44512871-44512893 GCAGTTTACAGGTAATACAGGGG + Intergenic
1192460414 X:71312419-71312441 CTAGTTAAAAGGTAATAAATGGG + Intergenic
1194687487 X:96940351-96940373 CTAGTTAACTGGGAATATATCGG + Intronic
1194840497 X:98735072-98735094 CTATTTTATAAGCAAGACATTGG - Intergenic
1198313788 X:135446398-135446420 CTAGTCTACATGGAAGACATGGG - Intergenic
1201574243 Y:15445041-15445063 CTAGATTAGAGGAAATACAGGGG + Intergenic