ID: 920017712

View in Genome Browser
Species Human (GRCh38)
Location 1:202927096-202927118
Sequence CGGTGCGGCTGTGTGGGTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 144}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920017712_920017734 25 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017734 1:202927144-202927166 GAGTGCGGCGCGGGGCTAGCAGG 0: 1
1: 0
2: 2
3: 9
4: 112
920017712_920017720 -3 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017720 1:202927116-202927138 CCGGGCCCGTCCCCAGCCTGTGG 0: 1
1: 0
2: 2
3: 41
4: 366
920017712_920017735 28 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017735 1:202927147-202927169 TGCGGCGCGGGGCTAGCAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 187
920017712_920017729 10 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017729 1:202927129-202927151 CAGCCTGTGGGGATGGAGTGCGG 0: 2
1: 0
2: 5
3: 68
4: 616
920017712_920017733 17 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017733 1:202927136-202927158 TGGGGATGGAGTGCGGCGCGGGG 0: 1
1: 0
2: 2
3: 16
4: 224
920017712_920017725 3 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017725 1:202927122-202927144 CCGTCCCCAGCCTGTGGGGATGG 0: 1
1: 1
2: 1
3: 46
4: 357
920017712_920017721 -2 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017721 1:202927117-202927139 CGGGCCCGTCCCCAGCCTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 192
920017712_920017722 -1 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017722 1:202927118-202927140 GGGCCCGTCCCCAGCCTGTGGGG 0: 1
1: 1
2: 4
3: 33
4: 292
920017712_920017732 16 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017732 1:202927135-202927157 GTGGGGATGGAGTGCGGCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 306
920017712_920017731 15 Left 920017712 1:202927096-202927118 CCCGAACCCACACAGCCGCACCG 0: 1
1: 0
2: 1
3: 7
4: 144
Right 920017731 1:202927134-202927156 TGTGGGGATGGAGTGCGGCGCGG 0: 1
1: 0
2: 5
3: 27
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920017712 Original CRISPR CGGTGCGGCTGTGTGGGTTC GGG (reversed) Exonic
900447472 1:2688544-2688566 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900450324 1:2746324-2746346 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900475718 1:2875502-2875524 CTGTGCAGCCGTGTGGGTTATGG + Intergenic
900702966 1:4059277-4059299 CTGTGTGGATGTGGGGGTTCAGG + Intergenic
902184142 1:14712408-14712430 CTGAGATGCTGTGTGGGTTCAGG + Intronic
903605768 1:24574071-24574093 GGGGGCCGCTGTGTGGGTCCTGG - Intronic
907136276 1:52142218-52142240 CGATGCGGCTGGGCGGGTGCCGG + Exonic
908786134 1:67736399-67736421 AGGTGCTGTGGTGTGGGTTCTGG - Intronic
912446776 1:109742341-109742363 CGGAGCTGCTCTGAGGGTTCTGG + Intronic
912798744 1:112707570-112707592 CGGCGCGGGTGTGTTGGTTGGGG + Intronic
913251187 1:116912941-116912963 CTATGTGGCTGGGTGGGTTCTGG - Intronic
916211159 1:162360959-162360981 TGGTGTGGCTGGGTGGGTTGAGG + Intronic
918208282 1:182328715-182328737 AGCTGCGGCTGTGTGGGTTCAGG + Intergenic
920017712 1:202927096-202927118 CGGTGCGGCTGTGTGGGTTCGGG - Exonic
922620354 1:226984810-226984832 TGGTGCGGGTGTGTGGGGCCGGG - Intronic
1064203092 10:13300510-13300532 CGGTGCGGCAGGGAGGGTCCTGG - Intronic
1065183116 10:23146389-23146411 CGGAGCAGCTGTGTGCGGTCAGG - Intergenic
1067462469 10:46467828-46467850 CAGGGCAGCTGTGTGGGGTCTGG + Intergenic
1067624727 10:47916809-47916831 CAGGGCAGCTGTGTGGGGTCTGG - Intergenic
1070329757 10:75408769-75408791 CAGGGCGGCTGTGCGGGGTCTGG - Intergenic
1073455284 10:103633054-103633076 GAGTGGGGCTGTGTGGCTTCAGG - Intronic
1073488873 10:103839590-103839612 GGGTGGGGCTGTGTGGGCTTGGG - Intronic
1075844169 10:125531767-125531789 CAGCGCGGTTGTGTGAGTTCTGG - Intergenic
1076167960 10:128297476-128297498 CGGTGGGGGTAGGTGGGTTCTGG + Intergenic
1076946090 10:133651483-133651505 GGGTGCGGATGGGTGGGTCCTGG - Intergenic
1077155299 11:1088416-1088438 AGGAGCGGCGGTGCGGGTTCAGG - Intergenic
1077244417 11:1529256-1529278 CAGTGTGGCTCGGTGGGTTCCGG + Intergenic
1077998804 11:7476394-7476416 AGGTGTGGCTGGGTGGGCTCAGG - Intergenic
1082784445 11:57309175-57309197 GTGTCCAGCTGTGTGGGTTCTGG - Exonic
1083887370 11:65579364-65579386 CGGTGCCCCGGTATGGGTTCTGG - Exonic
1089396508 11:118139387-118139409 CGATGCTGCTGTGGGGGTTCAGG - Intronic
1092494668 12:8980734-8980756 GGGTGCAGCAGTGTGAGTTCTGG + Intronic
1094040986 12:26122155-26122177 GGGTGCGGCCGTGCGGGTGCTGG + Exonic
1098383850 12:69897954-69897976 AGCTGCAGCTGTGTGAGTTCAGG + Intronic
1100616457 12:96235189-96235211 GGGGGCGGCTGTGGGGGTGCAGG - Intronic
1102543163 12:113636947-113636969 CAGTGCTGGTCTGTGGGTTCTGG - Intergenic
1103592833 12:122004426-122004448 CGGGGCTGCTCTGTGGTTTCTGG - Intergenic
1104017848 12:124972366-124972388 CGGTGCTGCTGTGTGACTTTGGG - Intronic
1104470377 12:129025203-129025225 AGGTGTGGGTGTGTGGGTGCAGG - Intergenic
1109253349 13:60048015-60048037 CCGTGCGACTGGGTGGGTTAGGG - Intronic
1110887713 13:80658991-80659013 GGGTGGGCCTGTGAGGGTTCTGG - Intergenic
1113910695 13:113839921-113839943 CGGGGCGGCTGTGGGGTCTCGGG + Intronic
1117478895 14:56123575-56123597 CTGTGTTGCTGTGTGGTTTCTGG + Intronic
1121521672 14:94590338-94590360 CCCTGGGGCTGTGTGGGTTTAGG - Intronic
1122627360 14:103091366-103091388 CCGCTCGGCTGTGTGGGTCCCGG - Intergenic
1202929242 14_KI270725v1_random:23790-23812 CTGTGCGGCTGTGGGGGGTGGGG + Intergenic
1124004627 15:25785927-25785949 TGGTGGGGCTGTGCGGGGTCCGG + Intronic
1128148134 15:65344141-65344163 CGGGGAGGCTGTGTGGCATCTGG + Intronic
1129272834 15:74428507-74428529 CTGTCAGGCTGTGTGGGTTGGGG + Intronic
1132557030 16:577047-577069 CTGTGTGGCTGTGGGGGTGCAGG + Intronic
1134679352 16:16113268-16113290 CGTTGTTGCTGTGTGAGTTCAGG - Intronic
1136620180 16:31423417-31423439 CGGGGTGGCTGTGTGGGATGTGG + Exonic
1137512803 16:49116148-49116170 CCTTTCGGCTGTGTGAGTTCTGG - Intergenic
1142287806 16:89178551-89178573 CGGTGGGGCTGGGTGGGGTGGGG - Intronic
1143584067 17:7842742-7842764 CTGTGTGTCTGTGTGTGTTCAGG + Intronic
1144954771 17:19013516-19013538 CGGTGAGGCTGTGTGGGTGGGGG + Exonic
1145235232 17:21203211-21203233 GGGTGCGTCTGTGTGTGTTTTGG - Intronic
1146936723 17:36816695-36816717 AGGGGAGGGTGTGTGGGTTCTGG - Intergenic
1147267439 17:39243385-39243407 CTCGCCGGCTGTGTGGGTTCTGG + Intergenic
1149863174 17:60135616-60135638 CGTTGCAGCTGTGTGGGCGCTGG - Intergenic
1150316960 17:64176956-64176978 CTGTGGGGCTGGGTGGGCTCTGG + Intronic
1150619905 17:66800289-66800311 GAGTGCTGCTGTGTGGCTTCTGG - Intronic
1152721377 17:81925362-81925384 AGGTGGGGCTGTCTGTGTTCAGG - Intronic
1157304769 18:46508946-46508968 CTGTGCGGCTCTGTGCCTTCAGG - Intronic
1157604566 18:48917769-48917791 GGGTGGAGGTGTGTGGGTTCTGG - Intergenic
1157810515 18:50692196-50692218 CAGTGAGGCAGTGTGGCTTCTGG - Intronic
1161349895 19:3785782-3785804 TGGGGCGGCTGTGTGTGTGCCGG - Intronic
1162054797 19:8056130-8056152 CTGGGCGGCTGTGTGGTTGCAGG + Exonic
1163271919 19:16259659-16259681 CTGGGCTGCTGTGTGGCTTCAGG - Intergenic
1163697360 19:18770565-18770587 CGGTGTGTGTGTGTGGGTTGTGG + Intronic
1167137479 19:47625842-47625864 CCGTGGGGCTGTGTGGGGGCCGG + Intronic
929613606 2:43290723-43290745 CAGTGTGGCTGTGTGGAATCTGG + Intronic
931656091 2:64511875-64511897 CGGGGCGGCTGTGCGGGTGGGGG + Intergenic
933773919 2:85760356-85760378 CGGTGCGGGTGGGTGGGCTCTGG + Intronic
938071691 2:128311768-128311790 CTGTGAGCCTGTGTGGGTGCAGG - Intronic
942401915 2:175611710-175611732 AGGTATGGCTGTGTGAGTTCTGG + Intergenic
946975414 2:225142863-225142885 CGGTGGGGTTGTGTGTGTTGGGG + Intergenic
947349210 2:229225289-229225311 CGGTGCTTCTCTGTGGGTACAGG - Intronic
948607736 2:239146769-239146791 CAGTGGGGCTGTGGGGGGTCAGG - Intronic
1169934582 20:10869875-10869897 TGGTGAGGCTGTGTGGGATAGGG + Intergenic
1171229056 20:23467583-23467605 CGGTGGGACAGTGTGGGGTCTGG + Intergenic
1173166297 20:40689225-40689247 CGGTGCAGCTGTGCTGGATCCGG + Exonic
1174070794 20:47897702-47897724 CGGTGCTGCTGTGTAGTTTGAGG + Intergenic
1174100356 20:48122289-48122311 CGGTGCTGCTGTGTAGTTTGAGG - Intergenic
1174100517 20:48123192-48123214 CGGTGCTGCTGTGTAGTTTGAGG - Intergenic
1174153272 20:48500954-48500976 CGGTGCTGCTGTGTAGTTTGAGG - Intergenic
1174321759 20:49747653-49747675 CAGTGCGGCTCTGTGGGTGAAGG - Intergenic
1175279451 20:57793437-57793459 GGGTGGGGCTGTGTGTGTGCAGG + Intergenic
1175373836 20:58511143-58511165 CAGGGAGGCTGTGTGGGTCCAGG + Intronic
1181584267 22:23844610-23844632 AGCTGCTGCTATGTGGGTTCCGG - Intergenic
1183705365 22:39472268-39472290 AGGAGAGGCAGTGTGGGTTCAGG + Intronic
1184561010 22:45262945-45262967 CGGTGCAGCTATGTGGGATGTGG + Intergenic
955006271 3:54971638-54971660 CACTGAGGCAGTGTGGGTTCTGG - Intronic
961717381 3:128867269-128867291 CAGTGCAGCTGTGTGGCCTCAGG - Intergenic
961717401 3:128867501-128867523 CTGTGCAGCTGTGTGGCCTCAGG - Intergenic
961717414 3:128867661-128867683 CTGTGCAGCTGTGTGGCCTCAGG - Intergenic
961717419 3:128867701-128867723 CTGTGCAGCTGTGTGGCTTCAGG - Intergenic
964282251 3:155079755-155079777 CGGTGAGTCTCTGTGGGTGCGGG + Exonic
967019280 3:185508316-185508338 TGGGGCTGCTGTGTGGGTTTGGG - Exonic
968085161 3:195870901-195870923 TGGGCCCGCTGTGTGGGTTCTGG + Intronic
968085170 3:195870930-195870952 GGGGCCCGCTGTGTGGGTTCTGG + Intronic
968085188 3:195870989-195871011 GGGGCCCGCTGTGTGGGTTCTGG + Intronic
968495859 4:914929-914951 CGCTGGGGCTGTGTGTGTTGGGG - Intronic
968495873 4:914991-915013 CGCTGGGGCTGTGTGTGTTGGGG - Intronic
968495881 4:915022-915044 CGCTGGGGCTGTGTGTGTTGGGG - Intronic
968949389 4:3682779-3682801 CGCTGAGGCTGTGTGTGTCCTGG + Intergenic
969340821 4:6539863-6539885 CCGTGCAGCTGTGTGGGTAGAGG + Intronic
969718661 4:8881022-8881044 GGGTGGGGCTGTGTGGGTGCAGG - Intergenic
971294835 4:25378829-25378851 CTGTTTGGCTGTGTGGGTGCAGG + Intronic
973642102 4:52913638-52913660 GGGTGGGGCGGTGTGGTTTCAGG - Intronic
985138428 4:186812936-186812958 TGGTGTGGCTGTGTGTGTTTGGG + Intergenic
985449500 4:190052137-190052159 GGGTGCGGATGGGTGGGTCCTGG - Intergenic
985569908 5:639258-639280 GGCAGCGTCTGTGTGGGTTCCGG + Intronic
991109838 5:62887091-62887113 CGTTGTGGTTGAGTGGGTTCTGG + Intergenic
992645254 5:78805768-78805790 CCGGGTGGCTCTGTGGGTTCCGG + Intronic
997170504 5:131714442-131714464 CAGTGCAGGTGTGTTGGTTCGGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
999874257 5:155784593-155784615 CCATGGGGCTGTGTTGGTTCTGG + Intergenic
1000636131 5:163645612-163645634 CAGTGTGGCTGTGTGAGGTCTGG + Intergenic
1002058894 5:176614668-176614690 GGGTGCAGGTGTGTGGGGTCTGG - Intergenic
1003366479 6:5479818-5479840 AGGTGTGGCTGTGTGGGTTTTGG - Intronic
1006446476 6:34082556-34082578 CTGGGCGGCTGTGTGACTTCAGG - Intronic
1006456414 6:34134502-34134524 AGCTGAGGCTGTGGGGGTTCTGG + Intronic
1006593133 6:35172706-35172728 CTGGGAGGCTTTGTGGGTTCTGG - Intergenic
1006800386 6:36756147-36756169 CCGTGCGTCTGTGTGTGTGCAGG - Intronic
1013861169 6:114637283-114637305 TGCTGTGGCTGTGTGGATTCAGG + Intergenic
1016432998 6:144007888-144007910 CGGTGGGGCTGCCTGGGTTGCGG + Intronic
1017040962 6:150308320-150308342 TGGTGGGGCTGTGTTGGGTCAGG + Intergenic
1017733466 6:157338905-157338927 AGGTTCAGCTGTGTGGTTTCAGG + Intergenic
1017826110 6:158083332-158083354 CGTTGAGGGTGTGTGGGTTTTGG + Intronic
1019294559 7:266971-266993 GGCTGCTGCTGTGTGGGGTCTGG + Intergenic
1019535012 7:1524187-1524209 TGGGGTGGTTGTGTGGGTTCAGG - Intergenic
1019606535 7:1912905-1912927 GGGCGGGGCTGTGTGGGCTCCGG + Intronic
1021228679 7:18059191-18059213 CTCTGGGGCTGTGTGGGTTTGGG - Intergenic
1022565228 7:31392700-31392722 CCTTGAGGCTGTGTGGCTTCTGG + Intergenic
1025233756 7:57219942-57219964 CGGTGCTGCTGTGTAGTTTGAGG + Intergenic
1025869215 7:65415148-65415170 GAGTGCGGCTCTGTGGGTGCAGG - Intergenic
1029110629 7:98211561-98211583 CGGTGGGGTTGTGGGGGTTGTGG + Intronic
1031971263 7:128066657-128066679 CGGTGTGGCTGTGTGTGACCGGG + Intronic
1033474184 7:141674866-141674888 CGGTGCTGCCTTCTGGGTTCTGG - Intronic
1035066343 7:156107937-156107959 AAGTGCCGCTGTGTGGCTTCTGG + Intergenic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1035637529 8:1157590-1157612 CGGTGGCGCTGTGTTTGTTCTGG + Intergenic
1039764115 8:40609856-40609878 CACTGCGGTTGTGTGGGCTCAGG - Intronic
1053886772 9:42649845-42649867 GGGTGAGGGTGTGTGGGTTAGGG - Intergenic
1054225791 9:62457295-62457317 GGGTGAGGGTGTGTGGGTTAGGG - Intergenic
1057274898 9:93670973-93670995 AGGTGCAGCTGTGTCTGTTCAGG + Intronic
1062290866 9:135793787-135793809 GGGAGAGGCTGTGTGGATTCAGG + Intergenic
1062395835 9:136352424-136352446 CGGTGTGGCTGGGTGTGGTCTGG + Intronic
1203621291 Un_KI270749v1:131153-131175 CTGTGCGGCTGTGGGGGGTGGGG + Intergenic
1189280967 X:39820092-39820114 CGGTGCGGCTGAGTTGGACCCGG + Intergenic
1190055680 X:47179896-47179918 CCATGGTGCTGTGTGGGTTCAGG - Exonic
1198377351 X:136052961-136052983 CGGTGGGGCTGTGTTTGTTCTGG - Intergenic