ID: 920019206

View in Genome Browser
Species Human (GRCh38)
Location 1:202941330-202941352
Sequence GTAGATGCCTTGCTGAGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920019206 Original CRISPR GTAGATGCCTTGCTGAGGAG GGG Exonic
901070870 1:6517631-6517653 TCAGATTCCTTGCTGGGGAGGGG + Intronic
903340371 1:22650760-22650782 GTGTCTGCCTTGCTGAGGGGAGG + Intergenic
903345859 1:22683981-22684003 GTACATGGGTTGCTGGGGAGAGG + Intergenic
905481423 1:38264614-38264636 GTAGATGCCTTGTTCAGAACAGG + Intergenic
910375447 1:86564313-86564335 GTAGATGTCCTGCTGGGGCGTGG + Intronic
915264743 1:154708890-154708912 GAGGCTGCCTTGCTGAGGTGTGG + Intronic
918241824 1:182627079-182627101 GTAGATGCCTGGTTGGGGACAGG - Intergenic
918966939 1:191362961-191362983 GTAAAGGCCATTCTGAGGAGAGG + Intergenic
919429862 1:197479188-197479210 GTAGATGTTTTGCTGAAAAGGGG - Intergenic
920019206 1:202941330-202941352 GTAGATGCCTTGCTGAGGAGGGG + Exonic
921249880 1:213287396-213287418 GTAAATGCCTTGAGGAAGAGTGG - Intergenic
921569087 1:216757020-216757042 GGAAATGCCTTTATGAGGAGAGG - Intronic
922559214 1:226556216-226556238 GTAGATAGCTTGCTAAGCAGAGG + Intronic
924272614 1:242349433-242349455 GAATATGCCTAGCTGAGAAGAGG + Intronic
1063000234 10:1911059-1911081 GTGGATGCCTTACCCAGGAGTGG + Intergenic
1065130699 10:22617091-22617113 GTCAATGCCTTGCTCAGGAGAGG - Intronic
1065867589 10:29927310-29927332 GGGGAGGCCTTGCTGAGAAGGGG - Intergenic
1067278159 10:44852295-44852317 GTAGGGGCCTGGGTGAGGAGAGG + Intergenic
1067290151 10:44934361-44934383 GTAGATGGGTTCATGAGGAGGGG - Intronic
1068771325 10:60825049-60825071 GTTGATGCCTAACTGAGCAGGGG + Intergenic
1070349281 10:75576277-75576299 GCAGTGGCCTTGCTGAGGTGTGG - Intronic
1070976575 10:80610197-80610219 GGAAAGGCCTTTCTGAGGAGGGG - Intronic
1074017157 10:109545832-109545854 GCAGATGCCTTGCTGAGCTGTGG - Intergenic
1075399131 10:122149115-122149137 GTGGCTGCCTTGGTGAGGTGAGG - Intronic
1076293800 10:129368189-129368211 GGAGATGCCTTCATAAGGAGTGG - Intergenic
1077009029 11:371914-371936 GAAGTTGCCTTGCTGGGGGGAGG + Intronic
1077351683 11:2095983-2096005 GGAGATGCTTTTGTGAGGAGGGG - Intergenic
1080038959 11:27738811-27738833 GTAGGAGCCTTGCTAAGTAGAGG + Intergenic
1080824702 11:35837929-35837951 GGATGTGCCTTGCTGAGTAGTGG - Intergenic
1083482981 11:62961622-62961644 GTTGTTGACCTGCTGAGGAGAGG + Intronic
1083847843 11:65346374-65346396 GAAGGAGCCATGCTGAGGAGGGG - Intronic
1085320125 11:75568924-75568946 GTAGAGGCCTGGGAGAGGAGCGG - Exonic
1091186301 11:133650747-133650769 GGAGATGGCTTGTTGAGGAAAGG + Intergenic
1095611782 12:44137469-44137491 GAAGATGCCTTGCAGAGTGGAGG + Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1097185046 12:57192263-57192285 GTAGATGCCTTGGTGGGAAGGGG - Intronic
1102170605 12:110839551-110839573 GAAGATGGCTTTCGGAGGAGTGG - Intergenic
1102638037 12:114341686-114341708 GGAGATGTTTTGCAGAGGAGAGG - Intergenic
1103247703 12:119472269-119472291 TTAGATGCCAGGCTGAGAAGGGG - Intronic
1105824080 13:24106538-24106560 GTAGGTGCATTGCTCAGCAGTGG + Intronic
1107059265 13:36138786-36138808 ATAGATGCCAGGCTGATGAGGGG - Intergenic
1112218689 13:97464282-97464304 GCAGAGCCCTTGCTGAAGAGTGG + Exonic
1113135569 13:107085219-107085241 GCAAATGCCTTGGTGTGGAGAGG - Intergenic
1115171965 14:30518651-30518673 GTTGAGGCCTAGCAGAGGAGAGG - Intergenic
1120086510 14:80280960-80280982 GTACATTCCAAGCTGAGGAGAGG + Intronic
1121221319 14:92287878-92287900 GAAGATGCCTTCCTTTGGAGAGG - Intergenic
1121307320 14:92915198-92915220 GAAGCTGCATTGCTGATGAGGGG + Intergenic
1122339355 14:101018347-101018369 GAGGATGCGTAGCTGAGGAGCGG + Intergenic
1122474064 14:101993669-101993691 GGAAAGGCCTTGCTGAGAAGGGG - Intronic
1122814285 14:104304679-104304701 GCAGATGCCTTCCTGAGAACAGG + Intergenic
1126605428 15:50471497-50471519 GTAGATTCCTTTCTAAGGTGAGG - Intronic
1130210197 15:81915253-81915275 CTAGAAGCCTGGCTGAGGACAGG + Intergenic
1131853311 15:96565546-96565568 GCAAATGCATTGCTGAGGTGGGG + Intergenic
1133376724 16:5293354-5293376 GTGGATGCCTAGCAGAGGTGGGG - Intergenic
1134076436 16:11295238-11295260 GTAGATGCCTGGATGAAGAGAGG + Intronic
1134861848 16:17567276-17567298 GCAGATGACTTAGTGAGGAGTGG - Intergenic
1136065248 16:27754219-27754241 GTAGATGCCTGGCTCTGGCGTGG - Exonic
1137471078 16:48759119-48759141 GTGGCAGCCTTGCTGGGGAGGGG + Intergenic
1138414132 16:56861567-56861589 GCAGATGCCTCTCTGAGGAGGGG + Intergenic
1140267505 16:73433437-73433459 TTGGGCGCCTTGCTGAGGAGGGG - Intergenic
1143208511 17:5164682-5164704 GTTGATGCCTTGCTAGGGAGTGG + Intronic
1143339035 17:6194569-6194591 GCAGATGCTTGGCTGAGCAGTGG + Intergenic
1143620097 17:8075759-8075781 GGAGAAGCCTGGCTGAGGAGTGG - Intronic
1148136722 17:45297357-45297379 GAAGATCCCTTACTGATGAGGGG + Intronic
1149664211 17:58354446-58354468 GTAGCAGCCTTACTGTGGAGGGG + Exonic
1149871765 17:60188877-60188899 ATTGATGCCTTGCTAGGGAGTGG - Intronic
1151849033 17:76678821-76678843 GAAGATGCGGGGCTGAGGAGAGG - Intronic
1155080548 18:22406237-22406259 GCAGAGGCCTTGCTGAGCTGTGG - Intergenic
1155384960 18:25267185-25267207 GCAGAGGCCTTGCTGAGCTGCGG - Intronic
1158230147 18:55245529-55245551 GGAGCTGCCGTGCTGTGGAGGGG + Intronic
1158531837 18:58269605-58269627 GTAGATGTATTGCTTGGGAGAGG + Intronic
1160722161 19:602510-602532 CCAGATGCCTTACTGAGAAGCGG - Intronic
1163814075 19:19453125-19453147 GGAGAAGCCTCGCTGAGGAGGGG - Intronic
1164403997 19:27925500-27925522 ATAGATGCTTTGGTGAGGAAAGG + Intergenic
1164937994 19:32229827-32229849 GTGGCTGCCTTGCTGTGGTGCGG - Intergenic
1165222963 19:34332280-34332302 AGAGATGCCTTGCTGAAGCGTGG + Intronic
1165430770 19:35770900-35770922 CTAGTTGCCATGCTGGGGAGGGG + Intronic
1167008885 19:46793224-46793246 ACAGATGCCTAGCTGAAGAGTGG - Intergenic
1167719468 19:51168468-51168490 TTGGAGGCCTTGCTGAGTAGGGG + Intergenic
927474442 2:23401697-23401719 GAAGGTGCATTGCTGAGCAGAGG + Intronic
937206415 2:120239630-120239652 GCAGAGGGCTTGCTGAGGGGAGG - Intergenic
937593816 2:123648521-123648543 GAAGCATCCTTGCTGAGGAGAGG - Intergenic
940005531 2:149006564-149006586 GTAGAAGGATTGCTGAGCAGTGG + Intronic
940291108 2:152078320-152078342 GGAGATGCTTTGATGAGGTGAGG - Intronic
943716800 2:191161065-191161087 GCAGAGGCCTTGCTGAGCTGTGG - Intergenic
944240551 2:197481301-197481323 GTAGATGGCTTGCAGAGCGGGGG + Intergenic
944456150 2:199896801-199896823 GTAGTGGCCTTGCTGGGCAGTGG - Intergenic
946903803 2:224396872-224396894 GCGGATGCCTGGCTGAGGATAGG + Intronic
948742634 2:240057579-240057601 GATGGTGCCTGGCTGAGGAGCGG + Intergenic
1168794604 20:603205-603227 GAATGTACCTTGCTGAGGAGAGG + Intergenic
1169268057 20:4179477-4179499 CTAGAGGCCATTCTGAGGAGGGG + Intronic
1174360795 20:50027890-50027912 GTGTCTGCCATGCTGAGGAGAGG + Intergenic
1175222835 20:57427102-57427124 GTGGAGGCCTTGCTGTGGGGTGG - Intergenic
1175882593 20:62269527-62269549 GACGCTGCCTTGCTCAGGAGAGG - Intronic
1176146117 20:63566295-63566317 GCCGATGCCAGGCTGAGGAGTGG + Intronic
1185394859 22:50581708-50581730 GGAGGTGCCTTGGGGAGGAGAGG + Intronic
949498529 3:4656120-4656142 GCAGAAGCCTGGCAGAGGAGCGG - Intronic
952517665 3:34122202-34122224 GCAGAGGCCTTGCTGAGCTGCGG + Intergenic
953459669 3:43072516-43072538 GTAGATGCATGTGTGAGGAGAGG - Intergenic
953874478 3:46658361-46658383 GCAGATGCCTTGCTAAGGCTGGG - Intergenic
954654690 3:52186680-52186702 GGAGAGGCCTCTCTGAGGAGAGG - Intergenic
955209322 3:56926185-56926207 GGAGTTGCCAGGCTGAGGAGAGG + Intronic
955322369 3:57983477-57983499 GTTGAGGGCTTACTGAGGAGGGG - Intergenic
955387052 3:58488546-58488568 GCAGAAGCCTTGCTGCGGAGAGG + Intergenic
960637381 3:119796721-119796743 GCAGATGCCATGCTGAGGCTGGG - Intronic
962290228 3:134129631-134129653 GTGGATGCCTAGTTGAGAAGAGG - Intronic
962832791 3:139158960-139158982 CTAGACCCCTGGCTGAGGAGAGG + Intronic
965653783 3:170962106-170962128 GTAAATTCTTTGCTGAGGAGTGG - Intergenic
967195890 3:187025407-187025429 GTAGCTGTGTTGCTGGGGAGGGG + Intronic
967210762 3:187166472-187166494 GTAGATGACCTGCTTAGGAGAGG + Intronic
967654813 3:192034256-192034278 GTAGTTGCCAGGCTCAGGAGTGG + Intergenic
968976608 4:3825340-3825362 GGAGATGACATGTTGAGGAGGGG - Intergenic
969469720 4:7380512-7380534 GTAGTTCTGTTGCTGAGGAGGGG + Intronic
971353647 4:25874812-25874834 CTAGATGTCTTGCTTGGGAGAGG + Intronic
972171791 4:36354772-36354794 GGAGATTCATTGCTGAGGAATGG - Intergenic
972263836 4:37439826-37439848 GTAGGTGCCTTGTTTATGAGAGG - Intronic
972630644 4:40838871-40838893 GTAGATGCCTTTTGGAAGAGAGG - Intronic
975025588 4:69544346-69544368 ACTGATGCCATGCTGAGGAGGGG - Intergenic
979779989 4:124638833-124638855 GTTGAAGCCTAGCTGAGAAGAGG - Intergenic
980962408 4:139488662-139488684 GTAGAGGCCTTGCTGAGGACAGG - Intergenic
986062413 5:4203777-4203799 GAAGAGACCTTGCAGAGGAGGGG + Intergenic
987561800 5:19533282-19533304 GTTGATGCTTTGTTGAGTAGAGG + Intronic
988818648 5:34859422-34859444 GCAGATGCCCAGATGAGGAGGGG - Intronic
990739948 5:58902393-58902415 CTGGTTGCCTTGCTGAGAAGTGG + Intergenic
991161394 5:63507670-63507692 GCAGTGGCCTTGCTGAGGTGAGG - Intergenic
991408183 5:66321837-66321859 CTAGAACCCTTGCTGGGGAGAGG + Intergenic
993670359 5:90752936-90752958 GTAGCTGCATTGCTGGAGAGTGG + Intronic
996416133 5:123212600-123212622 GTAGATGCCTTGCCCAGGAAGGG - Intergenic
999538172 5:152541618-152541640 TTAGATGCTTAGCTTAGGAGTGG + Intergenic
999947920 5:156617618-156617640 AGAGATGACTGGCTGAGGAGAGG + Intronic
1006773842 6:36576706-36576728 GTAGAGGCCTTGCCGAGATGAGG - Intergenic
1007134613 6:39508751-39508773 ATAGAGGCCTTGCTGAGCTGCGG - Intronic
1009711627 6:67329594-67329616 GCAGATGCTTTGCTGAAGATGGG + Intergenic
1012059998 6:94466263-94466285 GTAGCTGCCTTTCTTAGGAGGGG + Intergenic
1014768515 6:125434764-125434786 CTAGATGTCTTGCTGTGGAATGG + Intergenic
1015827845 6:137335024-137335046 GCACATGCCATGCTGGGGAGCGG - Intergenic
1018832881 6:167459102-167459124 GGAGAAGCCTTGCTGAGAACAGG + Intergenic
1019587443 7:1813143-1813165 GGAGATCCCTGGCTGTGGAGGGG + Intergenic
1020564876 7:9782474-9782496 GTAGATGAGCTGCCGAGGAGAGG - Intergenic
1021490188 7:21211189-21211211 GAAAATGCCTTGCAGGGGAGAGG + Intergenic
1023618644 7:42047354-42047376 GTAGACGCCTTCCTGAGGCTGGG - Intronic
1024022625 7:45385779-45385801 GTAGCTGGCTGGCTGGGGAGGGG + Intergenic
1024245211 7:47464497-47464519 GGAGATGACTTGCTGGGGTGGGG - Intronic
1024694638 7:51842523-51842545 GGTGAAGCCTTGCTGAGGAAAGG + Intergenic
1026819641 7:73538092-73538114 GGAGGTGGCTTGGTGAGGAGGGG + Intronic
1028432348 7:90762110-90762132 ATGGAAGCCTTGTTGAGGAGAGG + Intronic
1029017601 7:97330239-97330261 GCAGAGGCCTTGCTGAGCTGTGG - Intergenic
1029510814 7:100993846-100993868 GTAGATGCCTCACTGAGGCCTGG - Exonic
1029511308 7:100997095-100997117 GTAGATGCCTCACTGAGGCCTGG - Exonic
1029511534 7:100998517-100998539 GTAGATGCCTCACTGAGGCCTGG - Exonic
1029512032 7:101001766-101001788 GTAGATGCCTCACTGAGGCCTGG - Exonic
1029959951 7:104680232-104680254 GGAGGTTCCCTGCTGAGGAGGGG - Intronic
1030020033 7:105264524-105264546 GTAGCTGTCTTGTTCAGGAGAGG - Intronic
1033535379 7:142307548-142307570 GTTGATGGCTGGCAGAGGAGAGG + Intergenic
1034464433 7:151218180-151218202 GTAGATGCAAGGCTGAGGTGGGG + Exonic
1035281635 7:157782161-157782183 GTAGACCCCATGCTGAGGGGCGG + Intronic
1035645292 8:1214225-1214247 GGAGAGGACTTGCTGAGGAGGGG - Intergenic
1036215559 8:6877281-6877303 GTGGATGCATTTCTCAGGAGAGG + Intronic
1037607458 8:20449664-20449686 GGAGCTGCCTTTCTGAGAAGGGG + Intergenic
1037884206 8:22587903-22587925 GCACATGCCTTGGTGAGCAGAGG + Intronic
1037945316 8:22986040-22986062 GTAGTTGCCTTCCAGAGGAGTGG + Intronic
1039568981 8:38571847-38571869 GTACATGCCCTGCTGAGCTGAGG + Intergenic
1040939174 8:52815346-52815368 GGAGATGCCGTGCTGGGGAGAGG + Intergenic
1041221565 8:55656645-55656667 GCAGAGGCCTTGCTGAGCTGTGG - Intergenic
1041512155 8:58664177-58664199 GTGGATGCTTTGGTGAGGGGAGG - Intergenic
1042805145 8:72763340-72763362 GTAATTGCCTTGGGGAGGAGGGG - Intronic
1042853503 8:73240575-73240597 CTAGAGGCCTTGCTGAGCTGCGG + Intergenic
1043248302 8:78034633-78034655 GTATAAGCCTTTCTGTGGAGAGG + Intergenic
1049497405 8:142942765-142942787 GCACATGCCTTCCAGAGGAGAGG + Intergenic
1049586782 8:143436053-143436075 GGAGAAGGCTTCCTGAGGAGAGG - Intergenic
1052447282 9:28579314-28579336 GGAGATGCCTTTCTGAGGGAGGG + Intronic
1190418279 X:50202397-50202419 GTTGAGGCCTAGCTGAGAAGTGG + Intergenic
1192486479 X:71531570-71531592 GTTTAGGCCTTGCTGATGAGCGG - Intronic
1195960023 X:110376784-110376806 GTACCTGCCTTGCAGAGGTGTGG + Intronic
1196999730 X:121426022-121426044 ATATGTGCCTTGCTGAGCAGGGG + Intergenic
1199669410 X:150130460-150130482 GGAGATGCCTTGCTGCCGAATGG - Intergenic
1201061015 Y:10046841-10046863 ATATATCCCCTGCTGAGGAGAGG + Intergenic