ID: 920021118

View in Genome Browser
Species Human (GRCh38)
Location 1:202957753-202957775
Sequence GGCTGTTCCCCGCTGAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920021106_920021118 30 Left 920021106 1:202957700-202957722 CCTGCCAAAGATTGTTGGTGGAG 0: 1
1: 0
2: 0
3: 2
4: 79
Right 920021118 1:202957753-202957775 GGCTGTTCCCCGCTGAGAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 131
920021108_920021118 26 Left 920021108 1:202957704-202957726 CCAAAGATTGTTGGTGGAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 103
Right 920021118 1:202957753-202957775 GGCTGTTCCCCGCTGAGAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 131
920021114_920021118 -7 Left 920021114 1:202957737-202957759 CCTGGCAACCCAATGCGGCTGTT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 920021118 1:202957753-202957775 GGCTGTTCCCCGCTGAGAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 131
920021112_920021118 4 Left 920021112 1:202957726-202957748 CCTTAGGGCTTCCTGGCAACCCA 0: 1
1: 0
2: 0
3: 12
4: 165
Right 920021118 1:202957753-202957775 GGCTGTTCCCCGCTGAGAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920021118 Original CRISPR GGCTGTTCCCCGCTGAGAGG CGG Intronic
900193278 1:1360368-1360390 GGCTGTTTCCCACTGAGGGCCGG - Intronic
900830964 1:4965103-4965125 GGCTGGTCCCCGGCGTGAGGAGG - Intergenic
901065331 1:6491503-6491525 GACTGGTCCCCGGAGAGAGGTGG - Intronic
902648267 1:17819218-17819240 GGCTCTGCCCTGCTGAGAGCAGG - Intronic
902780462 1:18701689-18701711 GGCTGTTCACCCCAGAGTGGGGG - Intronic
903736692 1:25534427-25534449 GTCTTTCCCCCGCTGAGATGTGG + Intergenic
904346074 1:29870818-29870840 AGCTGTTCCCTGCTGAGACCAGG - Intergenic
905274338 1:36807354-36807376 GGCTGATCCCTGCTGGGAGCAGG - Intronic
905371742 1:37486140-37486162 GGCAGCTTCCCTCTGAGAGGGGG + Intergenic
906814233 1:48861781-48861803 GGCTACTCCCTGCTGAAAGGAGG - Intronic
907790702 1:57660697-57660719 GGCTGTTCTCCTGGGAGAGGAGG - Intronic
909481283 1:76130824-76130846 GGTTGCACCCCGCTCAGAGGTGG + Intronic
913997098 1:143660596-143660618 ATCTGCTCCCCGCTGAGGGGAGG - Intergenic
916737391 1:167619955-167619977 GGCTGTTCTCTGTTGAGAAGAGG + Intergenic
920021118 1:202957753-202957775 GGCTGTTCCCCGCTGAGAGGCGG + Intronic
920068685 1:203287384-203287406 GGCTGGTCCCCACAGGGAGGAGG + Intergenic
924358931 1:243215406-243215428 GGCTGTTCCTTGCTGAGAAAAGG - Intronic
1063443339 10:6090642-6090664 ATCTGTTCCCTGCTGGGAGGAGG - Intronic
1069571438 10:69496694-69496716 GGCTAGTCCCCACTGAGAGCTGG - Intronic
1069740434 10:70683734-70683756 GGCTGTGCTCCGCTGAAGGGTGG + Intronic
1072473181 10:95733181-95733203 GGCTGTTCCTTGCTGAGAAAAGG + Intronic
1072637417 10:97186646-97186668 GCTTGTTCCCCTCTGAGAAGTGG - Intronic
1074497958 10:113996404-113996426 TGCTGTTCCCAGCACAGAGGAGG + Intergenic
1075438890 10:122463840-122463862 TGCTGTTCCCAGCTCTGAGGGGG - Intronic
1076717079 10:132371613-132371635 GCCTGTGCCCAGCTGAGACGTGG - Intronic
1077233647 11:1469674-1469696 GGCTGTTGGCAGCTCAGAGGTGG - Intronic
1079237485 11:18700615-18700637 GGCTGTTGCTGGCAGAGAGGAGG + Intronic
1079240192 11:18717032-18717054 GGCTGGTCCCTCCTGAGGGGTGG + Intronic
1080070516 11:28079106-28079128 GGCCCTTCCCTCCTGAGAGGAGG + Intronic
1083781917 11:64923215-64923237 GGCTGTAGCCAGCTGGGAGGTGG + Intronic
1084430300 11:69107123-69107145 GGCTGATGCCTGCGGAGAGGTGG + Intergenic
1087870317 11:103285711-103285733 CACTGTGCCCGGCTGAGAGGAGG + Intronic
1088649782 11:111947309-111947331 GGCTGTTACTCTCTGAAAGGTGG - Intronic
1088981727 11:114870649-114870671 GGCTGTTGCCTGGAGAGAGGTGG + Intergenic
1091587278 12:1823420-1823442 GGCTGTTCCGTGCTCTGAGGGGG + Intronic
1092163716 12:6329892-6329914 TGCGGCTCCCCGCAGAGAGGTGG - Exonic
1092477664 12:8832705-8832727 GGCTTCTTCCTGCTGAGAGGGGG + Intronic
1093261313 12:16940881-16940903 GGCTGTTCCCAGGGGAGTGGGGG - Intergenic
1093401484 12:18752484-18752506 GGTAGGTCCCAGCTGAGAGGAGG + Intergenic
1096658635 12:53107219-53107241 GGCTACTTCCTGCTGAGAGGGGG + Intronic
1097066220 12:56322747-56322769 GGCTGGGCCCCACTGTGAGGGGG + Exonic
1098389841 12:69957960-69957982 CTCTCTTCCCCGCTGAGAGAGGG + Intronic
1103398446 12:120625850-120625872 GGCTGGTCGGCGGTGAGAGGGGG - Intergenic
1103778280 12:123382714-123382736 CGCTGTTCCCCTCTGAGAGAGGG - Intergenic
1104947408 12:132422290-132422312 GACTGTTGCCCATTGAGAGGTGG - Intergenic
1108373548 13:49793076-49793098 CGCTCTTCCCCGCCCAGAGGCGG - Intergenic
1120045657 14:79802733-79802755 TGGTGTTTCCTGCTGAGAGGGGG - Intronic
1120427472 14:84366418-84366440 GGCTGTTGCCTCCTGAGATGTGG - Intergenic
1122135841 14:99632447-99632469 GGATGTTCTCAGCGGAGAGGAGG - Intergenic
1122722019 14:103727563-103727585 GGCGGATCCCCGCTGCGTGGTGG + Intronic
1124429519 15:29594390-29594412 GGCTGCTCCCAGGTGAGAGTTGG - Intergenic
1132901974 16:2261433-2261455 GGCTGCTTCCTGCTGAGAGAGGG - Intronic
1134846699 16:17446787-17446809 GGCTGTTCCCCGCTGAGGGTTGG - Intronic
1140419528 16:74807195-74807217 TGCTGTTCTCAGCAGAGAGGAGG + Intergenic
1141618980 16:85226690-85226712 GGGTGTCCCCTGCTGGGAGGTGG + Intergenic
1142022196 16:87790796-87790818 GGCTGCTCCTCTCTGGGAGGGGG - Intergenic
1142175210 16:88642131-88642153 GGCTGATGCCAGGTGAGAGGGGG + Intergenic
1142231831 16:88903646-88903668 GGGTGTTCCCGGCTGGGGGGGGG + Intronic
1142903890 17:3029748-3029770 CGCTGTGCCCCGCTGGCAGGAGG - Intronic
1147560424 17:41505474-41505496 GGCTCTTGCCAGCTGGGAGGAGG - Exonic
1147671937 17:42181253-42181275 GGCCGCTCCCCTCTGGGAGGAGG - Exonic
1147971117 17:44219514-44219536 GGCTGTGCCCGGCCGAGCGGGGG - Intronic
1148383628 17:47219173-47219195 GCCTGTTCCAGGCTGAAAGGCGG - Intronic
1151212399 17:72554497-72554519 GGCTGTTGCCTGCTGAGCGTGGG - Intergenic
1151585141 17:75004212-75004234 GCATGTTCCCTGCTGAGCGGAGG + Exonic
1152357140 17:79812858-79812880 AGCGGCTCCCCGCCGAGAGGAGG + Intergenic
1154036315 18:10805806-10805828 GGCTGTTAGCCACTGAGATGGGG + Intronic
1160433150 18:78826120-78826142 GGCTGCTCACCTTTGAGAGGGGG - Intergenic
1163220007 19:15911947-15911969 GGCTGGTGCCCGCTGAGGTGAGG + Intergenic
1163793942 19:19324996-19325018 GTATGTTCTCCGCTTAGAGGTGG + Intronic
1165012445 19:32858642-32858664 GGCTGTGCCCCGAGGCGAGGTGG - Intronic
1165330448 19:35138864-35138886 GGCTGTCCCCTGCTGAAAGAAGG - Intronic
1166107348 19:40603923-40603945 GGCAGTGCCCCGCCCAGAGGTGG + Intronic
1166248987 19:41552675-41552697 GGCTACTTCCTGCTGAGAGGGGG + Intronic
1166557480 19:43710482-43710504 GGCTCTGCCCCACAGAGAGGAGG - Intergenic
1166619660 19:44284800-44284822 GGCTGCTTCCTGCTGAAAGGGGG - Intronic
1167234265 19:48304133-48304155 GGCTGACCCCCGCAGGGAGGAGG - Exonic
1167703897 19:51066989-51067011 GGCTATTCCACACTGGGAGGAGG + Intergenic
1168069679 19:53942606-53942628 GGCTGCTCCCAGCTCAGAGCAGG - Exonic
924972684 2:143434-143456 GGCTGCTTCCTGCTGAGAGGGGG + Intergenic
924978179 2:196683-196705 GGCTGTGCCCACCTCAGAGGTGG + Intergenic
925196088 2:1927080-1927102 GGCTGGCCCCCGCTCACAGGAGG - Intronic
926310159 2:11669419-11669441 GTCTGTTCCCCGGGGAGAGGGGG + Intronic
941029322 2:160493498-160493520 GTCTGGTCCCGGCTGGGAGGTGG - Exonic
941282142 2:163565649-163565671 TGCTGTTTCCAGCTTAGAGGTGG + Intergenic
947968368 2:234301466-234301488 GGCTGGGCCCTGCTGAGAGCTGG - Intergenic
948575551 2:238947269-238947291 GGCTCTGCCCTCCTGAGAGGGGG - Intergenic
948575595 2:238947433-238947455 GGCTCTGCCCTCCTGAGAGGGGG - Intergenic
1169262439 20:4148748-4148770 GGCGGGTCCCCGCCCAGAGGCGG + Intronic
1171339399 20:24415528-24415550 GGCTGTTCCTTGCTGAGAAAAGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175920253 20:62447220-62447242 GGCTGGTCCCTGCTGAGCTGTGG + Intergenic
1175967859 20:62668646-62668668 GGCTGTTCCCGCCTGGGAAGGGG + Intronic
1176049103 20:63107290-63107312 AGGTGTCCCCCGCTCAGAGGTGG - Intergenic
1176197312 20:63843499-63843521 GGCTGTTCCAGGCTGAGGGAAGG - Intergenic
1179917947 21:44490148-44490170 AGCTGCTTCCCGCTGACAGGGGG - Intergenic
1181075499 22:20373346-20373368 GGCTGTTCTCTGCTTAGAGACGG - Intronic
1182550958 22:31100513-31100535 GGCTGTGCCCCGGGGAGAGGGGG - Intronic
1183589091 22:38769582-38769604 AGCTGGGCCCTGCTGAGAGGTGG + Intronic
1184897909 22:47422890-47422912 GGCTGTGCCCCACTGAAAGCAGG + Intergenic
951588883 3:24242251-24242273 GTCTGTTTCCTGCTGGGAGGGGG + Intronic
953554006 3:43928038-43928060 GGCCGTTCCATGCAGAGAGGTGG - Intergenic
954035509 3:47848973-47848995 GGCTGTCGCCGGCTGGGAGGAGG + Exonic
954129648 3:48553878-48553900 GGCTTTTCTCAGCTGAAAGGTGG - Intronic
954637514 3:52079281-52079303 GGCTGGGCCCCGCTGGGAGTTGG - Intronic
958598343 3:96260086-96260108 AGCTTTTCCCTGTTGAGAGGAGG + Intergenic
960556329 3:119034702-119034724 CGCTGTTCCCCGCGCAGAGCTGG + Exonic
962939993 3:140117022-140117044 TGCTGTTCCGGGCTGGGAGGGGG + Intronic
965879718 3:173373887-173373909 GGCTCTTCCCAGTTGAGAAGAGG - Intergenic
967388380 3:188931485-188931507 GGCTGCTCCCCGATGAAAAGAGG - Intergenic
968940183 4:3633625-3633647 GGCTGTCCCCTGCAGAGAGATGG + Intergenic
982959848 4:161822984-161823006 GTCTCTTCTCTGCTGAGAGGTGG - Intronic
983281488 4:165686506-165686528 GGTTCTTCCCTGCTGAAAGGGGG + Intergenic
985649561 5:1101090-1101112 GGCTGTTCCCAGGTACGAGGCGG - Intronic
985789159 5:1916106-1916128 ACCTGTACCCTGCTGAGAGGAGG + Intergenic
1000104750 5:158048740-158048762 GGATGGTGCCAGCTGAGAGGGGG + Intergenic
1001586132 5:172834734-172834756 GGCTGTTCCCATCTGGGAGGAGG - Intronic
1003577760 6:7313285-7313307 GGCTGCTCAGCGCGGAGAGGTGG + Intronic
1011325818 6:86149204-86149226 AGCTGTTTCCTGCTGATAGGGGG + Intergenic
1019543247 7:1560779-1560801 GGCTGCCCGCCGCTGTGAGGAGG - Intronic
1022439785 7:30424126-30424148 GGCTGTTCACTGCTGAGTGGCGG - Intergenic
1023782379 7:43669129-43669151 GGCTATTTCCTGCTGAGAAGGGG - Intronic
1025850605 7:65240142-65240164 GGCTGGTCCTTGCCGAGAGGAGG - Intergenic
1033870641 7:145750361-145750383 GGCTGCTTCCTGCTGACAGGTGG + Intergenic
1034150877 7:148914597-148914619 GGCCTTTCCCCGCTGATGGGAGG + Intergenic
1035125765 7:156607195-156607217 GGCGGTCCCCTGCTGAGGGGGGG - Intergenic
1035293048 7:157851925-157851947 GGGTGTTGCCCGCAGCGAGGTGG - Intronic
1035398373 7:158549657-158549679 GGCTGATCTCCTCTGGGAGGCGG - Intronic
1035590567 8:810023-810045 GGCTGAGCCCTGCTGAGAGGAGG - Intergenic
1054450573 9:65401672-65401694 GGCTGTCCCCTGCAGAGAGATGG - Intergenic
1056623829 9:88237612-88237634 GGCTGTTCTCTGTTGGGAGGAGG - Intergenic
1059856460 9:118403529-118403551 GGCTGGTCTCCGCTGAGGGCTGG - Intergenic
1060544752 9:124453365-124453387 CGCTGTTCTCCGATGGGAGGCGG + Exonic
1061464090 9:130764061-130764083 GGGTGTTCCAGGCTGAGGGGAGG + Intronic
1062337767 9:136079935-136079957 AGCTGTTCCCCAGGGAGAGGCGG + Intronic
1062499867 9:136847679-136847701 CGGTGCTCCCCGCTGGGAGGCGG + Exonic
1185838024 X:3363119-3363141 TGCTGTTCCCTGCTGAGATGTGG - Intergenic
1190008092 X:46759049-46759071 TGCTGGTCCCCGCTCGGAGGAGG - Exonic
1193955148 X:87850812-87850834 GGCTTTTCCTGGCTGAGAAGAGG - Intergenic
1197892744 X:131282215-131282237 GGCTGTGCCATACTGAGAGGTGG + Intronic
1201237830 Y:11928640-11928662 CACTGTTCCCTGCTGAGATGTGG + Intergenic