ID: 920028108

View in Genome Browser
Species Human (GRCh38)
Location 1:203016254-203016276
Sequence GGGGACTAATGTAAACTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920028097_920028108 19 Left 920028097 1:203016212-203016234 CCAGCTTCCTTGATGGGGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 258
Right 920028108 1:203016254-203016276 GGGGACTAATGTAAACTTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 96
920028100_920028108 12 Left 920028100 1:203016219-203016241 CCTTGATGGGGAGGGGTGTAGGT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 920028108 1:203016254-203016276 GGGGACTAATGTAAACTTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920028108 Original CRISPR GGGGACTAATGTAAACTTCA GGG Intronic
904701011 1:32358025-32358047 GGGGACAGATGTAACCTTTAGGG + Intronic
906298695 1:44665206-44665228 GGAGGCTACTGTAAAATTCAAGG + Intronic
907176071 1:52523656-52523678 TGGGAAAAATGTAAACATCATGG - Intronic
907563360 1:55411416-55411438 GGGGACTATTATAACCTTCCAGG + Intergenic
909090947 1:71224871-71224893 GGGGAACTATTTAAACTTCAGGG - Intergenic
911262595 1:95703447-95703469 GGGGAATAATATAAATATCAAGG + Intergenic
914695543 1:150075354-150075376 GAGGAATATTTTAAACTTCAAGG - Intronic
918179570 1:182074723-182074745 AGGCACCAATGTAAGCTTCAGGG + Intergenic
919174212 1:193999505-193999527 GGGGACAAATAAAAACTTCAAGG - Intergenic
920028108 1:203016254-203016276 GGGGACTAATGTAAACTTCAGGG + Intronic
920509162 1:206538078-206538100 GGGAACTAATGCAATCTCCAAGG + Intronic
1064221627 10:13445758-13445780 GGGGGTGAATATAAACTTCAAGG + Intronic
1064299382 10:14109650-14109672 TGGAAATAATGTAAACTTCTAGG - Intronic
1064566638 10:16646512-16646534 GGGGACCAATGGGAACATCAGGG - Intronic
1064768833 10:18702669-18702691 GGGTAATGATGTTAACTTCAAGG + Intergenic
1067741384 10:48898266-48898288 AGGGAGTAGGGTAAACTTCAGGG + Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1072966653 10:99979541-99979563 GGGGACTAAACTAAGCTTCTTGG - Intronic
1077943367 11:6868272-6868294 GGTGAATAATTTGAACTTCAAGG - Intergenic
1081197431 11:40178566-40178588 GGGGACAAATGTAAAACACATGG - Intronic
1081493441 11:43583758-43583780 GGGGCCTGATGGAAACTTCCAGG + Intronic
1082009814 11:47442311-47442333 GGGGACAAATGTTTCCTTCAGGG + Intronic
1085596604 11:77816821-77816843 GAGGACTAAAGTAGACTGCAGGG + Intronic
1088159955 11:106856905-106856927 GGGGACTAGTATAAACTGTACGG - Intronic
1090913126 11:131139089-131139111 GGAGAGCAATGTAAACATCATGG + Intergenic
1091938170 12:4450093-4450115 GGGGACTAAGGTATTCTTCCTGG - Intergenic
1095299696 12:40569273-40569295 GGGAACAAATGTAATTTTCATGG + Intronic
1096417969 12:51430028-51430050 GGGGACTGAAGGAAAGTTCAGGG + Intronic
1099717893 12:86320014-86320036 TTGGAATACTGTAAACTTCAAGG + Intronic
1104172286 12:126293459-126293481 GGGGACTTGTGTAAAATGCAGGG + Intergenic
1107734171 13:43378700-43378722 GGGTCCTAAAATAAACTTCACGG + Intronic
1110384073 13:74888181-74888203 GGGTACAAATGCAACCTTCAAGG + Intergenic
1113315724 13:109177163-109177185 ACGGACTAGAGTAAACTTCATGG - Intronic
1117409449 14:55438007-55438029 AGCAACTAATGTAAAATTCATGG + Intronic
1117444115 14:55787468-55787490 GGGGACAAATGGAAGCTTCCAGG + Intergenic
1118176213 14:63442474-63442496 GGGGACTACTGTATACATCCTGG - Intronic
1119778227 14:77261156-77261178 GGGGACTTTTGTAAAATACAGGG - Intergenic
1126448333 15:48776420-48776442 GGGTAATAATGTAAACTTTAGGG + Intronic
1130408513 15:83624488-83624510 GGGGACAAATATTAACATCAAGG + Intergenic
1134759502 16:16701519-16701541 GGTGCCTAATGTTAATTTCAGGG + Intergenic
1139655607 16:68385443-68385465 GGTGACAAATGTAACCTTCAGGG - Intronic
1150669027 17:67173398-67173420 AGGGAATTATGTAAACTTTAAGG - Intronic
1151253217 17:72854136-72854158 GGGGATTAATCTCTACTTCATGG - Intronic
1159561627 18:70001341-70001363 GGGGACTAGTTCATACTTCATGG - Intergenic
1162866182 19:13548923-13548945 GGGGACTCAAGAAAACTGCAAGG - Intronic
926084090 2:10010192-10010214 TGTGACTCATGTAAACTTCAGGG - Intergenic
930536201 2:52648918-52648940 GCAGACTAAGGCAAACTTCATGG - Intergenic
934947219 2:98550540-98550562 GGGGCCTAATGCAAAGTCCAAGG + Intronic
937401592 2:121588604-121588626 GGAGACTACTGCATACTTCATGG - Intronic
938624632 2:133094897-133094919 GGGGGCTACTCTAAACTTCTAGG - Intronic
944444458 2:199775442-199775464 GGGAACTGATGAAAACTTGAGGG + Intronic
947337428 2:229101956-229101978 TGGGTCTAATGTAATCATCAAGG + Intronic
1170805739 20:19629425-19629447 GTGGACCAATGTACACATCATGG + Intronic
1175244458 20:57573213-57573235 GGGGACTAATGCCAACCCCAAGG - Intergenic
1177704596 21:24686150-24686172 GGGGTCTAATGTAAAGTTGGAGG - Intergenic
953073339 3:39545390-39545412 GGGGACTATCATAAACATCAAGG + Intergenic
966516312 3:180824407-180824429 GGGGACAAAAGAAAACTACAAGG + Intronic
972959960 4:44441721-44441743 GGGAACTAATGTCAAGCTCAAGG + Intronic
973744490 4:53950020-53950042 GCGGACTAACTTAAACTCCAGGG - Intronic
979664155 4:123292747-123292769 GGAGAATGATGTAAGCTTCATGG - Intronic
980811003 4:137880329-137880351 GGGGACTAATTACTACTTCAAGG + Intergenic
985161556 4:187050073-187050095 GAGGACTCATTTAAAATTCATGG + Intergenic
985899592 5:2778246-2778268 GGGGACTATTGCAAACACCACGG - Intergenic
988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG + Intronic
995749748 5:115441582-115441604 GGAGACTAATGTGAACAACAGGG - Intergenic
997008779 5:129851565-129851587 TGGCACTAATATAAGCTTCAGGG - Intergenic
1000169563 5:158688606-158688628 GGAGTCTAATCTAATCTTCAGGG + Intergenic
1010693303 6:78936897-78936919 GGGAACTAAGGGAAACTGCAAGG + Exonic
1011631973 6:89336059-89336081 GAGGACTCTTGTAAACTTCAAGG - Intronic
1012240613 6:96867605-96867627 GGGGACTCAGGTAGACTTTACGG + Intergenic
1014051875 6:116964322-116964344 TGGGCCCAATGTAAACTGCATGG - Intergenic
1015363656 6:132372246-132372268 GGTGAGGAATGTAACCTTCATGG + Intronic
1016722242 6:147313909-147313931 GGGGACTCATGTATACTCAAAGG - Exonic
1021237977 7:18166630-18166652 GAGGACTAATAAAAGCTTCATGG + Intronic
1021405470 7:20262548-20262570 GGAGGCTAAGGTAAAGTTCATGG - Intergenic
1024673700 7:51619478-51619500 AGGGACTACTGTAACATTCATGG - Intergenic
1027753135 7:82177239-82177261 GGTGAATAAGGTGAACTTCAAGG - Intronic
1031137311 7:117899313-117899335 GTAGACAAATGTGAACTTCAGGG - Intergenic
1033115818 7:138624167-138624189 GGGAACTAAGGTGAACTTGATGG - Intronic
1035025590 7:155823123-155823145 GGGGACAAATGTTTACTTCGTGG + Intergenic
1035257729 7:157642530-157642552 GGGAACTCATGGAAACTTCCTGG - Intronic
1035611718 8:970539-970561 TTGGACTAATGTAAACATGAGGG + Intergenic
1037762083 8:21748227-21748249 GGGGACTATTGCCACCTTCATGG - Intronic
1041467462 8:58171134-58171156 GTGGACTAATATCAACTGCATGG + Intronic
1042804249 8:72754822-72754844 GCGGACTTATATAAATTTCATGG - Intronic
1045640194 8:104241293-104241315 AGGGAATTATGTAAACTTCTGGG + Intronic
1046587216 8:116162253-116162275 AGGTACTAATGAAAACTTCAAGG - Intergenic
1047470070 8:125162027-125162049 GGGGGCTAAAATAAACCTCAGGG - Intronic
1048382668 8:133881270-133881292 AGAGACTAAAGTAAACTACAAGG - Intergenic
1048814544 8:138319842-138319864 GGAGATTATTCTAAACTTCATGG + Intronic
1051796391 9:20876264-20876286 TTGGACTCATGTTAACTTCAGGG - Intronic
1052039062 9:23717408-23717430 GGGGATAAATGTAAAGTACAGGG + Intronic
1052651095 9:31302264-31302286 GGGAACTAATTTAAACTAAAGGG + Intergenic
1052920576 9:33963794-33963816 GTGGACCAATGTAAAATTGAGGG + Intronic
1052992088 9:34524360-34524382 GGGGTCTTATGTGAATTTCATGG - Intergenic
1054844031 9:69773500-69773522 GGTGATTAATGAAGACTTCATGG - Intergenic
1187079087 X:15967096-15967118 AGGAACTAAGGTTAACTTCATGG - Intergenic
1187237875 X:17485197-17485219 GTGCACTAATTCAAACTTCAGGG + Intronic
1187635806 X:21226937-21226959 GGGGCGTAATGTATACATCAAGG - Intergenic
1188435289 X:30151798-30151820 TGGGACTAGTGCTAACTTCAAGG + Intergenic
1188678415 X:32971922-32971944 GGGGAGAAAAGTAAATTTCATGG + Intronic
1189962241 X:46334759-46334781 GGGGACTCACATAAACTTAAAGG + Intergenic
1194970374 X:100336859-100336881 TGGGACTAGTGTACACTTCTAGG + Intronic