ID: 920029700

View in Genome Browser
Species Human (GRCh38)
Location 1:203029073-203029095
Sequence GGGGAAACAGCAGTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1071
Summary {0: 1, 1: 0, 2: 8, 3: 198, 4: 864}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920029686_920029700 16 Left 920029686 1:203029034-203029056 CCTGAGGCAACTGAGAATGTCAC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG 0: 1
1: 0
2: 8
3: 198
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920029700 Original CRISPR GGGGAAACAGCAGTGGGGGA AGG Intronic
900034223 1:393518-393540 AGGGAAACAGCAGGGTGAGATGG - Intergenic
900055058 1:623408-623430 AGGGAAACAGCAGGGTGAGATGG - Intergenic
900136643 1:1120451-1120473 GGGGAAGCAGGGGTGGGGGGTGG + Intergenic
900416022 1:2535012-2535034 GCGGGAGCTGCAGTGGGGGAGGG + Intergenic
900427152 1:2586137-2586159 GGGGTCCCAGCAGTGGGGGGCGG - Intergenic
900514426 1:3074579-3074601 GGGGCAGGAGCTGTGGGGGACGG - Intronic
900743265 1:4343432-4343454 GGGGCTACTGCAGTGGGGGAGGG - Intergenic
900743272 1:4343452-4343474 GGGGCTATTGCAGTGGGGGAGGG - Intergenic
900743279 1:4343472-4343494 GGGGCTGCTGCAGTGGGGGAGGG - Intergenic
900743289 1:4343506-4343528 GGGGCTACTGCAGTGGGGGAGGG - Intergenic
900743301 1:4343544-4343566 GGGGCTATTGCAGTGGGGGAGGG - Intergenic
900743314 1:4343583-4343605 GGGGCTACTGCAGTGGGAGAGGG - Intergenic
900743319 1:4343603-4343625 GGGGCTATTGCAGTGGGGGAGGG - Intergenic
900743326 1:4343623-4343645 GGGGCTATTGCAGTGGGGGAGGG - Intergenic
900743338 1:4343663-4343685 GGGGCCATTGCAGTGGGGGAGGG - Intergenic
900743346 1:4343683-4343705 GGGGCCATTGCAGTGGGGGAGGG - Intergenic
901325191 1:8361183-8361205 GGGGGAACTGCAGTGGCAGAGGG + Exonic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901636207 1:10671453-10671475 GGGGAGACAGATGTGAGGGAAGG + Intronic
901760171 1:11465854-11465876 GGGAAATGAGCAGTGGCGGATGG - Intergenic
901989443 1:13100839-13100861 TGGGAAACACCTGTGGGTGAGGG - Intergenic
901992370 1:13125925-13125947 TGGGAAACACCTGTGGGTGAGGG + Intergenic
902709962 1:18232110-18232132 GTGGAGAAAGCAGAGGGGGATGG - Intronic
902832947 1:19029481-19029503 TGGGAAACGACAGTGGGGCAGGG - Intergenic
903203084 1:21759285-21759307 GGGAAGGCAGGAGTGGGGGAGGG + Intronic
903250313 1:22048571-22048593 GGGGAAACAGAACTGAGAGATGG - Intergenic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
904391499 1:30189160-30189182 GGGTAGACAGCAGGTGGGGAGGG - Intergenic
904493703 1:30875357-30875379 GGGGAAACAGTGATGGGGCACGG - Intronic
904500047 1:30908327-30908349 GGGGAAGCAGCCGGGGGGGAGGG + Intronic
904556654 1:31369355-31369377 AGGGAAACAGGGGTGGGGAATGG - Intronic
904590577 1:31613113-31613135 AGGGACACACAAGTGGGGGAAGG - Intergenic
904684162 1:32248631-32248653 GGGGAAGCGGCATTGGGAGAGGG - Exonic
904813293 1:33178153-33178175 GGGGAAACAGGAGAGGGAGAGGG - Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
905526187 1:38641794-38641816 GGGGAGTCGGAAGTGGGGGATGG + Intergenic
906282696 1:44565277-44565299 GGGGAAAATGCAGGGAGGGAGGG + Intronic
906742455 1:48196134-48196156 GGAGAGACAGCAGAGGGAGAAGG - Intergenic
907179006 1:52553346-52553368 GGGGAAACAGCACTGGGGGGAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907834252 1:58093994-58094016 GGGGAAACACCAGTGAAAGATGG + Intronic
908361960 1:63377439-63377461 AGGGAAACAGCAATTGCGGAAGG - Intronic
908445091 1:64192174-64192196 GGGGTAACACCACTGCGGGATGG + Intergenic
908886422 1:68794665-68794687 GGGGCAAGTGCAGTGGGGTAGGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909007696 1:70296780-70296802 AGGGAAGCAGCAGAGAGGGAAGG + Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910180704 1:84479488-84479510 GTGGAAACAGCAGCAGCGGAAGG + Exonic
910333768 1:86105344-86105366 GGGGATGCTGCAGTGAGGGAAGG + Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
910616954 1:89208955-89208977 GGGGAAAAATAAGTGGGAGATGG - Intergenic
910739070 1:90495082-90495104 GGGGAAACACCACAGGGAGAAGG - Intergenic
911029734 1:93473772-93473794 GTGGAGCCAGCAGTGGTGGATGG + Intronic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
911432684 1:97812051-97812073 GGGGAAGAAGCAGTGGGTAAAGG - Intronic
912382702 1:109255842-109255864 GGGACAACAGCAGAGGGGGCAGG + Intronic
912391778 1:109307838-109307860 GGAGAGGCAGCAGTGGTGGAGGG + Intergenic
912801699 1:112723464-112723486 GGGGAAGGAGCAGCAGGGGAAGG - Intronic
913245376 1:116865910-116865932 ATGGAAACAGGAGTGGGGAAAGG - Intergenic
913507017 1:119526486-119526508 GGAGACAGAGCACTGGGGGATGG - Intergenic
913703374 1:121396197-121396219 GGGTAAAAAGCCGTGGGGGCAGG - Intergenic
913939366 1:125087158-125087180 GGGTAAAAAGCCGTGGGGGCAGG + Intergenic
913979543 1:143497334-143497356 GGGTAAAAAGCCGTGGGGGCAGG - Intergenic
914044382 1:144078232-144078254 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
914133728 1:144882455-144882477 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
914411683 1:147435176-147435198 GGGGACACAGCTGTAGGTGACGG + Intergenic
915371358 1:155353825-155353847 GGGGAAATTGGGGTGGGGGACGG - Intronic
915525979 1:156476562-156476584 GGGGACAGAGGTGTGGGGGAGGG - Intronic
915527884 1:156487370-156487392 GTGGGAGCAGCAGTGGGGAAAGG - Intronic
915590266 1:156866605-156866627 GGGGCCAAAGCAGTGGGGGAGGG + Intronic
915842820 1:159229829-159229851 TCTGAAACAGCTGTGGGGGAGGG - Intergenic
915900678 1:159844565-159844587 GGGAAAAAAGCAGTGTAGGAGGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917525175 1:175782040-175782062 GAGAAAAAGGCAGTGGGGGAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917800295 1:178563534-178563556 GGGGAAACAGGAATGAGGAAAGG - Intergenic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
918756506 1:188345120-188345142 GAGGAAACAGAAGAGTGGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919568489 1:199218672-199218694 TGGGAAACTGCAGTGTGGGGAGG + Intergenic
919806976 1:201386107-201386129 GGGGCACCAGCTGTGGGGCAGGG - Intronic
919820297 1:201468286-201468308 GGGGAAAGAGAAGGGAGGGAAGG + Intronic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920038334 1:203080151-203080173 GGGAAAACAGAGGTGAGGGAAGG + Intergenic
920097965 1:203498854-203498876 GGGAAAAGAGGAGTGGGGGCAGG + Intronic
920263847 1:204707521-204707543 GGAGAAACAGGGATGGGGGAGGG - Intergenic
920271168 1:204765018-204765040 GTGGGAGTAGCAGTGGGGGAGGG + Intergenic
920298127 1:204972121-204972143 GGGGAATCAGCAGATGGGAAAGG - Intronic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920562600 1:206949377-206949399 GGGGAAACCACAGTGCGAGAGGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921155320 1:212433881-212433903 GGGGGAACGGCATTGGGGGGAGG + Intronic
921216304 1:212939818-212939840 GGGGAAAAAAAAGTGTGGGATGG - Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
922256579 1:223897687-223897709 AGGGAAACAGCAGGGTGAGATGG - Intergenic
922402763 1:225277077-225277099 GGGGAAATGGCAAGGGGGGAGGG + Intronic
922534208 1:226367975-226367997 GGGGAAAGAGCTGTTGGAGAGGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923104351 1:230843096-230843118 GGGGAAAGCGCAGTGGGCCACGG + Intronic
923121721 1:230998370-230998392 GAGGCAACAGGAGTGGAGGATGG - Intronic
923207973 1:231776886-231776908 GTGGAAGCAGCTGTGTGGGAGGG + Intronic
923525626 1:234770354-234770376 GGGGAATCAGCAGAGGGTGAGGG - Intergenic
923526487 1:234776759-234776781 AGGGACACCGCAATGGGGGAAGG + Intergenic
924337787 1:243000546-243000568 AGGGAAACAGCAGGGTGAGATGG - Intergenic
924338321 1:243004903-243004925 GATGAGACAGCACTGGGGGATGG - Intergenic
924652258 1:245940138-245940160 CGGGACACAGCACTGGGGGGAGG + Intronic
1063199458 10:3774064-3774086 GGCGAGACAGCAGTGTGGGATGG + Intergenic
1063691646 10:8293101-8293123 GGAGAAAGAGGAGTGGGAGAAGG + Intergenic
1064254330 10:13731278-13731300 GGGGAAACATCATTGGGTGAAGG + Intronic
1064403520 10:15040585-15040607 GGGGAAAGGGAAGTGGGGAAGGG - Intronic
1064678415 10:17784836-17784858 GGGGTAACTGCTGTGGGGAATGG + Intronic
1065009740 10:21410558-21410580 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1065078153 10:22101612-22101634 GAGGAGAGAGCAGTGGGGCAGGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065673190 10:28144639-28144661 GGGGACAAAGGAGTGGGAGATGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066950314 10:42111218-42111240 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
1067426873 10:46217254-46217276 TGGGCAACAGCGGTGGGGCAAGG + Intergenic
1067481023 10:46597765-46597787 GGGGAAGGAGCGGAGGGGGAAGG - Intergenic
1067613728 10:47744057-47744079 GGGGAAGGAGCGGAGGGGGAAGG + Intergenic
1067704196 10:48594887-48594909 GGGGACACAGTTGGGGGGGAGGG - Intronic
1068787224 10:60989778-60989800 GGGGAGAGAGCAGGGGTGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069543872 10:69315654-69315676 GGGGACACAGCAGTGCAGCATGG + Intronic
1069627993 10:69880237-69880259 GGGGAAGCAGCAGGAGGGAAAGG - Intronic
1069842019 10:71345843-71345865 GGGGAGACAGCCGTGGTGGGGGG + Intronic
1070636500 10:78132443-78132465 GAGGAAACAGAACTGGGAGATGG + Intergenic
1070761219 10:79025438-79025460 GGCGGCACAGGAGTGGGGGAGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071403595 10:85304763-85304785 GGGAAAACAGGAGTTAGGGAGGG - Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071629139 10:87204029-87204051 GGGGAAGGAGCGGAGGGGGAAGG + Intergenic
1071928297 10:90436738-90436760 GGGGAAAGAGGAATGGGGGAAGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073008356 10:100341445-100341467 GGGGAAGCAGCAGCTTGGGAGGG + Intergenic
1073212733 10:101818142-101818164 GGGGGAAGGGCAGAGGGGGAGGG - Exonic
1073434992 10:103510937-103510959 TGGGAAACAGCGGCGGGGGGTGG - Intronic
1073611263 10:104946329-104946351 GGGACAACAGCAGAGGAGGAGGG - Intronic
1073977543 10:109118070-109118092 TGGGGAACAGAAGAGGGGGATGG - Intergenic
1074447251 10:113530616-113530638 AGGGAAAGAGCAGTAGGGGAGGG + Intergenic
1074770873 10:116732930-116732952 GGGGAAACTGAAGTCAGGGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1074983670 10:118639471-118639493 GAGGAAGCATCACTGGGGGAGGG - Intergenic
1075634721 10:124022740-124022762 GGGGAAACATCAAGGGGGAAGGG - Intronic
1075645208 10:124092447-124092469 GAGGGGACAGCAGTGGGGGCGGG + Intronic
1075707160 10:124508192-124508214 GTGGAAACACCCATGGGGGAGGG - Intronic
1076286750 10:129306790-129306812 GTGGAACCATCTGTGGGGGAAGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076679156 10:132162873-132162895 GGGGATACAGCAAGGTGGGAGGG - Intronic
1076870048 10:133188689-133188711 GGTGGAACAGCAGTGGGGGGTGG - Intronic
1076900294 10:133334665-133334687 GGGGAAAGAACTGAGGGGGAAGG + Intronic
1077485721 11:2837604-2837626 GGGCAGACAGAGGTGGGGGATGG + Intronic
1077771913 11:5228161-5228183 GGGGAAAAAGTACAGGGGGATGG - Intronic
1078141896 11:8699179-8699201 GGGGAACCAGCTGGGGGGAAGGG - Intronic
1078869872 11:15333448-15333470 TGGGAAACAGCAGCTGGGGTGGG - Intergenic
1078970305 11:16402679-16402701 GGTGAAACAGGAGTGGGTGGAGG - Intronic
1079380523 11:19933711-19933733 GGAGAAACAACAGCGGGAGAAGG + Exonic
1079406861 11:20155660-20155682 GGGAAGACAGAAGTGGGGTAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080397453 11:31903078-31903100 GGGGAACCAGCAGGGGAAGAGGG + Intronic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1080938613 11:36888381-36888403 GGGGAAACTGCATTGGGGAAAGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081363235 11:42205288-42205310 GGGAAACCATCAGTGAGGGATGG + Intergenic
1081492522 11:43579397-43579419 GGGCAAACACCCGTGGGGGGCGG + Intronic
1081597129 11:44467140-44467162 GGGGAAGCAGGAATGGGGCAGGG + Intergenic
1082192308 11:49261331-49261353 GGGGAAACTGCAGGGAGTGAGGG - Intergenic
1082208508 11:49468446-49468468 GGGGAAAGAGGAGAGGGGGATGG + Intergenic
1083324788 11:61867695-61867717 GGGGAGACAGCTGGGGGGGGAGG - Intergenic
1083459169 11:62799471-62799493 GGGGCAACAGAGGTGGGGCATGG - Intronic
1083730719 11:64651056-64651078 GGGGAGTCAGCAGTGGAAGAGGG + Intronic
1083747003 11:64742352-64742374 GGGGAACCAGCTGGGGCGGAAGG + Intronic
1083882454 11:65555291-65555313 AGGGAAGGAGCAGAGGGGGATGG - Intronic
1084434697 11:69132055-69132077 GGGGTTACAGCAGGGAGGGAGGG - Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084906567 11:72352945-72352967 GGGGAATGAGCACTGGGTGAAGG - Intronic
1085101544 11:73804782-73804804 AGTGAAAAAGCAGTGTGGGAGGG + Intronic
1085255836 11:75172469-75172491 GGGGAAGAAGAAGTAGGGGATGG - Exonic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086641108 11:89156675-89156697 GGGGAAAGAGGAGAGGGGGATGG - Intergenic
1087891451 11:103542262-103542284 GGGGTAACACCACTGTGGGATGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088395500 11:109363500-109363522 GGAGAAAGAACAGTAGGGGAGGG - Intergenic
1088806547 11:113358328-113358350 GGGGAAGCTGCAGTGTGGGGAGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088898784 11:114098835-114098857 GGGGAAAAGGAAATGGGGGAGGG + Intronic
1088993093 11:114971522-114971544 GGGGAGACAGTAGTGGTAGACGG - Intergenic
1089640578 11:119844909-119844931 AGAGAAATGGCAGTGGGGGATGG - Intergenic
1090251486 11:125254838-125254860 TTGGAAACAGCAGATGGGGATGG + Intronic
1090312743 11:125756441-125756463 TGGGACAGAGCACTGGGGGAAGG + Intergenic
1090364943 11:126198009-126198031 GGGGATAGAGCAGTGTGGGAGGG - Intergenic
1092208399 12:6630863-6630885 CGGGAAGCAGAAGTGTGGGATGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093490689 12:19700951-19700973 GGGGAAGCTGCAGTCGGGGGAGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096463757 12:51837074-51837096 GGGGACACAGCAGGAGGGGTGGG + Intergenic
1097182557 12:57179646-57179668 GGGGGAACAGGACTGGGAGAAGG - Intronic
1097272675 12:57787302-57787324 GGGGATATAGCAACGGGGGAAGG - Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1097984512 12:65769353-65769375 GGGGAAACAGCAGAGGCAAAGGG - Intergenic
1098251897 12:68579030-68579052 GGAGAAACAGAAGGAGGGGAGGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099065993 12:77980004-77980026 GGGAAAACAGGAATGAGGGAGGG + Intronic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099394499 12:82121179-82121201 GGGGAGGCTGTAGTGGGGGAGGG - Intergenic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1101170406 12:102086659-102086681 GGAGAATGAGCAGTGGGTGAGGG - Intronic
1101225711 12:102686319-102686341 GGGGAAAGGGCAGTGGTGGTAGG - Intergenic
1102468603 12:113145741-113145763 GGGGGAGCAGGGGTGGGGGAAGG - Intergenic
1102749164 12:115277211-115277233 GGGGAAAGGGGAGGGGGGGAGGG + Intergenic
1102890265 12:116553109-116553131 GGGGAGACATCAGAGGGGTAGGG + Intergenic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103185965 12:118957687-118957709 GGGGGTGCAGCAGTGGGGGTGGG - Intergenic
1103419373 12:120768084-120768106 GTGGAAACAGCAGTAAGGCATGG + Intronic
1103844273 12:123890638-123890660 AGGGGAACAGGAGTGGGAGAGGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103969094 12:124658567-124658589 CGGGACACAGCAGAGGGTGAGGG + Intergenic
1104001702 12:124864196-124864218 GGGGAGACATAGGTGGGGGAAGG - Intronic
1104050856 12:125192719-125192741 GTGGAAACAGCAGATGTGGAAGG + Intronic
1104755994 12:131269634-131269656 GGGGACACAGCACTGGGCAAAGG + Intergenic
1104777719 12:131401047-131401069 GGGGACACAGCACTGGGCAAAGG - Intergenic
1104794960 12:131511034-131511056 GGGGAAACAGAAGGGGGTCATGG - Intergenic
1105396789 13:20043838-20043860 GGGGAAGCTGCAGTGTGGGGAGG + Intronic
1106335531 13:28779065-28779087 GGCGCAGCTGCAGTGGGGGAGGG + Intergenic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1107125347 13:36840156-36840178 GCGGAACCGGAAGTGGGGGATGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108095277 13:46894327-46894349 GGGCAAACTCCAGTGGGGGTAGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110610279 13:77480266-77480288 AGGGAGTCAGGAGTGGGGGAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1112333926 13:98498701-98498723 GGGGAGACGGCAGGGGAGGAGGG - Intronic
1113190578 13:107741244-107741266 GGGGAAACAACACTGAGAGAAGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114398755 14:22390081-22390103 GGGCACACAGCAGAAGGGGAGGG + Intergenic
1114602584 14:23968827-23968849 GGGGAAACAGTGGTGGTGGGTGG + Exonic
1114606953 14:24005956-24005978 GGGGAAACAGTGGTGGTGGGTGG + Exonic
1114750642 14:25200912-25200934 GGGGAAAAAGGAGGGAGGGAAGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116019380 14:39442013-39442035 TGGGAAGCAGCAGTGGGGCTGGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116899419 14:50347621-50347643 GGGGAAACTGGTTTGGGGGAAGG + Intronic
1117067619 14:52026176-52026198 GGGGAAAAAGGAATGGGAGAAGG + Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117202653 14:53408372-53408394 AGGGAGGCAGGAGTGGGGGAGGG - Intergenic
1117202675 14:53408429-53408451 AGGGAGGCAGGAGTGGGGGAGGG - Intergenic
1117534260 14:56688938-56688960 GTGGAAAGAGCACTGGGCGACGG - Intronic
1117792056 14:59351468-59351490 GTGGTAACATCAGTGGGAGAGGG - Intronic
1117828395 14:59726931-59726953 TGAGAAACAGCAGTGGGGGCGGG + Exonic
1118311801 14:64699232-64699254 GGGGAAGAAGCTGTGGGGGAAGG - Intergenic
1118478557 14:66141527-66141549 GGGGAAGTTGCAGTGTGGGAAGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119265858 14:73262924-73262946 GGAGAAACAGAAGTTAGGGATGG - Intronic
1119288595 14:73476249-73476271 GTGGAAACAGGAGAGGGGAAAGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120334058 14:83131025-83131047 GGGGAAAGAGCAGAAGGAGAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120425585 14:84343319-84343341 GGGGAAACAGAAGGGAGGAAAGG - Intergenic
1121262078 14:92573747-92573769 TGGGAACCAGCAGTGTGTGAGGG - Intronic
1121416570 14:93783407-93783429 GTGGAACCAGCACTGGGGAATGG - Intronic
1121567628 14:94922731-94922753 TGGGAAACAGCAGCAGAGGAAGG + Intergenic
1121711157 14:96039829-96039851 AGGGGGACAGCAGTGGGGGATGG - Intronic
1122126044 14:99579345-99579367 GGAGGAAGAGAAGTGGGGGAGGG + Intronic
1122204252 14:100140759-100140781 GGGGAAGCAGCAGCGGCGGCAGG - Intronic
1122301844 14:100735859-100735881 GGGCAAAGAGGGGTGGGGGAGGG - Exonic
1122536317 14:102466015-102466037 GTGGAGGCAGCAGTGGGGCAGGG + Intronic
1122978056 14:105179076-105179098 GGGGAAGCAGTGGTGGGGAAGGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123587457 15:21772713-21772735 GGGGAGAGAGGAGTGGGGGACGG + Intergenic
1123587467 15:21772734-21772756 GGGGAGAGAGGAGGGGGGGATGG + Intergenic
1123587477 15:21772755-21772777 GGGGAGAGAGGAGGGGGGGACGG + Intergenic
1123624095 15:22215278-22215300 GGGGAGAGAGGAGTGGGGGACGG + Intergenic
1123624105 15:22215299-22215321 GGGGAGAGAGGAGGGGGGGATGG + Intergenic
1123624115 15:22215320-22215342 GGGGAGAGAGGAGGGGGGGACGG + Intergenic
1123909759 15:24955364-24955386 GGGGTAACCGCAGTGGGCAAGGG + Intronic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124121647 15:26893702-26893724 GGGGGCACAGGAGTGGGCGAGGG + Intronic
1124126814 15:26944390-26944412 GCTGAAACTACAGTGGGGGAGGG - Intronic
1124486263 15:30119878-30119900 GGGAAAACAGGAGTTAGGGAAGG + Intergenic
1124541338 15:30588863-30588885 GGGAAAACAGGAGTTAGGGAAGG + Intergenic
1124547992 15:30650361-30650383 GGGAAAACAGGAGTTAGGGAAGG + Intronic
1124757320 15:32418724-32418746 GGGAAAACAGGAGTTAGGGAAGG - Intergenic
1125239553 15:37558352-37558374 GAGGAGACTGCAGTGGGGGCAGG - Intergenic
1125532754 15:40424265-40424287 AGGGAAGCAGCAGAAGGGGAAGG - Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126778459 15:52119106-52119128 GGAGAAACAGCAGAAGGGGAAGG + Exonic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127734315 15:61827822-61827844 GGGGAGGCGGGAGTGGGGGAGGG - Intergenic
1127756117 15:62094037-62094059 GGGGGAAGAGGAGTGGGGCAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128994379 15:72286103-72286125 GGGGAACCAGCAGAGGGCGTTGG - Exonic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129686503 15:77689163-77689185 GGAGAAGCAGCAGAGGTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129931154 15:79412175-79412197 GCGGAAACTGCAGTAGAGGAAGG - Intronic
1130042429 15:80415994-80416016 GGGGACACAGCAGTGGAGAGTGG - Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131244116 15:90775134-90775156 GTGGAAACAGCAGAAGTGGAAGG + Intronic
1131542736 15:93288529-93288551 AGCGAGACAGCCGTGGGGGAAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132358637 15:101193273-101193295 GGGGAGACAGCAGCGAGGGCAGG + Intronic
1132986188 16:2768907-2768929 GGAGGAACGGCAGTGGGGGGAGG - Intronic
1133231228 16:4367598-4367620 TGGGCCTCAGCAGTGGGGGAAGG + Intronic
1133322520 16:4923116-4923138 AGGGAAACTGCAGAAGGGGAGGG + Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1133976222 16:10601454-10601476 GGGGAAACTTCTTTGGGGGAGGG + Intergenic
1134122795 16:11596686-11596708 GGGGAAGGAGCAGGGGGAGAGGG + Intronic
1134305343 16:13027039-13027061 CCAGATACAGCAGTGGGGGAGGG - Intronic
1134443477 16:14313310-14313332 GGAGAAACAGGATTGGGGGTGGG + Intergenic
1134623924 16:15710568-15710590 GCAGAGACAGCAGTGGGGTAGGG + Intronic
1134799664 16:17071908-17071930 GGGGGAAAAGCAAAGGGGGAGGG - Intergenic
1134805123 16:17117880-17117902 GGGTATGCAGAAGTGGGGGAAGG - Exonic
1135135616 16:19884164-19884186 GGGGACACGGCGGTGGGAGATGG - Intronic
1135265814 16:21024553-21024575 AGGGAGACAGCAGGAGGGGAAGG + Intronic
1135425098 16:22328513-22328535 GGGGAAGCAGCAGTCTGGGGGGG - Exonic
1135591915 16:23711119-23711141 GGGGATGCAGCAGGGGAGGAAGG + Intronic
1135945398 16:26860550-26860572 GGGAAAACAGGAATGAGGGAGGG + Intergenic
1136056696 16:27695136-27695158 GAGGCAACAGCGGTGGAGGAGGG - Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136275677 16:29178004-29178026 GGGGAGACAGGAGTGGGGAGTGG + Intergenic
1136452940 16:30364623-30364645 GGAGCTACAGCAGTGGGGCAGGG - Intronic
1136508709 16:30722827-30722849 GGGAAAACAACACTGAGGGAAGG - Intronic
1136784249 16:32925388-32925410 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1136885535 16:33928418-33928440 GGGGAAACAGGAGTGGTGAGAGG + Intergenic
1137716864 16:50603472-50603494 GGGGAAAGAGGAGGGGGGCAGGG - Intronic
1137988373 16:53130009-53130031 AGAGAGACAGCCGTGGGGGAGGG - Intronic
1138544385 16:57706985-57707007 GGGGAAAGAGGATTGGAGGAAGG - Intronic
1138547243 16:57727239-57727261 GGGGTTACAGGAGTGGAGGAGGG + Intronic
1138810388 16:60142814-60142836 GGAGAAACAGAAGTGGAGAAAGG - Intergenic
1139959026 16:70707138-70707160 GGGAAGAGAGCAGAGGGGGAGGG - Intronic
1139960600 16:70715311-70715333 GGTGAAACAGATGTGGGGGAGGG - Intronic
1140663995 16:77212443-77212465 GGGGAAGCGGCAGTCGGGGGCGG - Intronic
1141523356 16:84596137-84596159 TGGGCAACCCCAGTGGGGGACGG + Intronic
1142080033 16:88144059-88144081 GGGGAGACAGGAGTGGGGAGTGG + Intergenic
1142209961 16:88804158-88804180 GGGGAAACAGGCGGGGGGGACGG + Intronic
1142226508 16:88880295-88880317 TGGGAATCAGCCTTGGGGGAGGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142330136 16:89446859-89446881 GGAGAAGCAGCTGTGGGGGCTGG - Intronic
1142381156 16:89732960-89732982 GCGAACACAGCAGAGGGGGAGGG - Intronic
1203086906 16_KI270728v1_random:1189394-1189416 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1142547411 17:714578-714600 GGGGAAACGGGAGTGCGGGAGGG - Intronic
1142591725 17:1009231-1009253 GGGTGGACAGCAGTGGGGAATGG - Intronic
1142591729 17:1009248-1009270 GGGTGGACAGCAGTGGGGGGTGG - Intronic
1142591735 17:1009265-1009287 GGGTGGACAGCAGTGGGGGGTGG - Intronic
1142597141 17:1035386-1035408 GGGGGAGCAGGTGTGGGGGATGG - Intronic
1142597167 17:1035447-1035469 GGGGGAACAGGTGTGGGGGATGG - Intronic
1142597180 17:1035477-1035499 GGGGGAGCAGGTGTGGGGGATGG - Intronic
1142597194 17:1035508-1035530 GGGGGAGCAGGTGTGGGGGATGG - Intronic
1142597220 17:1035567-1035589 GGGGGAGCAGGTGTGGGGGATGG - Intronic
1142597234 17:1035598-1035620 GGGGGAGCAGGTGTGGGGGATGG - Intronic
1142640371 17:1281748-1281770 GGGGAAACTGGATTTGGGGAGGG + Intronic
1142717716 17:1756023-1756045 GGTGAAAGTGAAGTGGGGGAGGG + Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1142759491 17:2034677-2034699 GGGGAAACTGGGGAGGGGGATGG - Intronic
1142982151 17:3678563-3678585 GGGGCTGCAGCAGTGGGGCAAGG - Intronic
1143485495 17:7251627-7251649 GGGGAGGGGGCAGTGGGGGAGGG + Intronic
1143524351 17:7463506-7463528 GGGGCAGTAGCAGTGGTGGAGGG - Exonic
1143739568 17:8942397-8942419 GGTGAGGCAGCAGTGGGGGCAGG - Intronic
1143780091 17:9224779-9224801 GGAGGAACAGCAGGTGGGGATGG + Intronic
1144474296 17:15571954-15571976 TGGGAAACGGCGGTGGGGGGAGG + Exonic
1144494952 17:15740362-15740384 GGGGCAACACCAGGAGGGGAAGG - Intronic
1144636346 17:16911497-16911519 GGGGACACAGCAGCAGGGAAAGG - Intergenic
1144905304 17:18636313-18636335 GGGGCAACACCAGGAGGGGAAGG + Exonic
1145327123 17:21842116-21842138 GGGGAAAAAGCCGTGGCGGCGGG - Intergenic
1145693156 17:26765988-26766010 GGGGAAAAAGCCGTGGCGGCCGG - Intergenic
1146305844 17:31729319-31729341 GGGGCCCCAGCAGTGGGGGAGGG - Intergenic
1146967012 17:37040601-37040623 TTGGCAACAGCAGTGGGGGTTGG - Intronic
1147169842 17:38611528-38611550 GGGGAAGCAGGAGGGAGGGAGGG + Intergenic
1147522706 17:41189885-41189907 AGGGGAACAGCAGTGGGTCATGG - Exonic
1147530416 17:41271309-41271331 AGGGGAACAGCAGTGGGTCATGG - Intergenic
1147946586 17:44083775-44083797 GGGCGTACAGCAGTGGGGGTGGG - Intronic
1147953771 17:44121410-44121432 GGGGAGACAGCAAGGGGGGGTGG - Intronic
1147991879 17:44338952-44338974 GGGGAAAAAGAGGTGGGGGTGGG + Intergenic
1148020136 17:44548034-44548056 GGGGAGGCAGCAGAGGGGGAGGG - Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148906371 17:50915015-50915037 GAGGAAAGAGCAGTGAGTGATGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149595746 17:57863541-57863563 GGTGAAGCAGCTGTAGGGGAGGG + Intronic
1149625277 17:58075200-58075222 GTGGAAAGAGGAGAGGGGGAGGG + Intergenic
1149656620 17:58312535-58312557 GGGGCCAAAGCAGTGTGGGAAGG - Exonic
1150220484 17:63493298-63493320 GGGGACACAGCACTGTGGGGAGG - Intronic
1150566764 17:66348761-66348783 GGTTGAACAGCAGAGGGGGAGGG + Intronic
1150710402 17:67526243-67526265 TGGGACGCAGCAGTTGGGGAAGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151280181 17:73068165-73068187 GGAGAAACTGCAGTGGAAGACGG + Intronic
1151390454 17:73783672-73783694 GGGGAACCTGCAGAGGAGGAAGG + Intergenic
1151819634 17:76490547-76490569 GGGGAACTGGCACTGGGGGATGG + Intronic
1152109829 17:78351839-78351861 GGGAAATCAGCAGGGAGGGAAGG - Intergenic
1152427462 17:80225976-80225998 GGGGAAACTGAGGTGGGGGCCGG - Intronic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1152630634 17:81409332-81409354 TGGGAGACAGAAGTGGGGGTGGG + Intronic
1152700015 17:81814044-81814066 GGGGCCGAAGCAGTGGGGGATGG + Intergenic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1152802921 17:82340117-82340139 GGGGAGAGGGCATTGGGGGAGGG - Intergenic
1153002946 18:472906-472928 GAGGAAAGAGCAGAGTGGGAGGG + Intronic
1153308556 18:3655077-3655099 TGGGAAATTGCAGTGGGGGTTGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153470885 18:5444010-5444032 GGGGCACCAGATGTGGGGGAAGG - Intronic
1153820902 18:8830519-8830541 AGGGGAGCAGCAGCGGGGGAAGG - Intronic
1153924424 18:9823242-9823264 GGGGAAGTAGGGGTGGGGGACGG + Intronic
1155304093 18:24462402-24462424 GGGGAAACTGGAGTGTGGGGCGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156011847 18:32505577-32505599 GGGGATAGACCAATGGGGGAGGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157422695 18:47559611-47559633 GGGGAGACAGGAGAAGGGGAAGG - Intergenic
1157446508 18:47750659-47750681 GGGGAAACAGCACCTAGGGATGG + Intergenic
1157605418 18:48923146-48923168 GGGGGAAAAGCAGAGGGGAAGGG + Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158943240 18:62425580-62425602 GGGAAAACAGCAGGGAAGGAGGG - Intergenic
1159149796 18:64505975-64505997 ATGGAAACAACACTGGGGGATGG - Intergenic
1159225309 18:65525766-65525788 GGGGGAGGGGCAGTGGGGGATGG + Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160342670 18:78102673-78102695 GTGCAAACAGCGGTGGGAGATGG + Intergenic
1160833940 19:1115968-1115990 GGGGAGAAAGCAGAGGGGCAGGG + Intronic
1161019257 19:2000281-2000303 GGGGCACCAGCTGTGGGTGATGG - Intronic
1161313526 19:3607506-3607528 CGGGAGGCTGCAGTGGGGGATGG + Intergenic
1161540001 19:4844802-4844824 GGGGAGAGAGAAGTGAGGGAAGG + Intronic
1161663405 19:5560721-5560743 GGGGAAACAGCCCAGGGGGTGGG + Intergenic
1161993172 19:7696977-7696999 GGGGATGGGGCAGTGGGGGAGGG - Intronic
1162079103 19:8208532-8208554 AGGGCAGCAGCAGTGGGGGCTGG - Intronic
1162450815 19:10753408-10753430 GGGGAAAGGGAAGTGGGGGGGGG - Intronic
1162950917 19:14071962-14071984 GGGGAAAGAGCAGCTGGGGCCGG - Intergenic
1163018532 19:14471025-14471047 GGGGGAACAAAAGTGGAGGAGGG - Intronic
1163214003 19:15862880-15862902 GGGGAAAGGGAGGTGGGGGAAGG - Intergenic
1163453933 19:17394981-17395003 GGGGTAACCGCATTGGGAGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165181268 19:33973036-33973058 GGACAAACAGGAGAGGGGGAGGG - Intergenic
1165225255 19:34350227-34350249 GGGGAATCGGCAGTGGGGTGTGG + Intronic
1166133797 19:40763203-40763225 GAGGAAGTAGCAGTGGGGGTGGG + Intronic
1166255304 19:41600121-41600143 GGGGCACCAGCTGTGGGGGACGG + Intronic
1166329330 19:42069495-42069517 GGGGAGAGAGGAGAGGGGGAAGG + Intronic
1167643211 19:50693295-50693317 GGGGACACTGAAGTGGGGGAGGG - Intronic
1167671800 19:50857847-50857869 TGGGAAACAGCAGTGTGAGAGGG - Intronic
1167694246 19:51004943-51004965 TGGTAAACAGAAGTCGGGGACGG + Intronic
1168072146 19:53959275-53959297 CGCGAAACAGAAATGGGGGAGGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168673696 19:58260798-58260820 GGAGAAGCATCAGAGGGGGAGGG - Intronic
1202681347 1_KI270712v1_random:6853-6875 GGGTAAAAAGCCGTGGGGGCAGG + Intergenic
1202683932 1_KI270712v1_random:31623-31645 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925280393 2:2680330-2680352 GGAGCAGCAGGAGTGGGGGAAGG + Intergenic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
926426956 2:12746898-12746920 GAGTCAACAGCAGTGGGAGATGG + Intergenic
926705767 2:15836359-15836381 GAGGAAACAGAAGTGGGTCAGGG + Intergenic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
927180794 2:20445611-20445633 GGGGAAAGGGGAGTCGGGGAGGG - Intergenic
927418319 2:22903016-22903038 GGCGTGACAGCAGAGGGGGAAGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928410174 2:31048587-31048609 GGGGAGGCAGGAGTGGGGGTGGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929311534 2:40431571-40431593 GGGGAAACTGAAGTAGAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930696909 2:54420895-54420917 GGGGGTAGAGCTGTGGGGGAAGG - Intergenic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931212552 2:60211800-60211822 GAGGAAACATCAGTGAGGGAAGG + Intergenic
931720940 2:65067385-65067407 GGGGGAACAAAAGTGGGGGAAGG + Intronic
931981034 2:67694495-67694517 GAGGAGAGAGGAGTGGGGGAAGG + Intergenic
932669959 2:73728663-73728685 GGGCAAAGAGCCATGGGGGAAGG - Intergenic
932675619 2:73778544-73778566 GGGGAAACAGGAGAGAAGGACGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933117740 2:78496080-78496102 GGAGTAACAGCAATGGGGCATGG + Intergenic
933766449 2:85712528-85712550 GTGGAACCAGAAGTGGAGGATGG + Intergenic
934260882 2:91477057-91477079 GGGGAAAAAGCCGCGGCGGATGG - Intergenic
934331417 2:92073283-92073305 GGGCAAAAAGCAGTGGGAGCGGG - Intergenic
934527806 2:95062402-95062424 GGGGAGACAGCTGTGTTGGAAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937062497 2:118990969-118990991 GGGGAAGCAGCAGCCGTGGATGG - Intronic
937127727 2:119484956-119484978 GGAGAAACAGCTGTGGGGGCAGG + Intronic
937569164 2:123334709-123334731 GGGGAAGCTGCAGTGTGGGGAGG - Intergenic
937577451 2:123441204-123441226 ATGGGAAGAGCAGTGGGGGAAGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937783261 2:125864724-125864746 GGGAAAACAGGAATGAGGGAGGG + Intergenic
938252739 2:129828155-129828177 GGAGCAGCAGAAGTGGGGGACGG + Intergenic
938278152 2:130046013-130046035 GGGGCTAGAGGAGTGGGGGAGGG - Intergenic
938437226 2:131291372-131291394 GGGGCTAGAGGAGTGGGGGAGGG + Intronic
938923232 2:136014691-136014713 GGGGAAGCAGCAGAGTGGGGAGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939152820 2:138493462-138493484 GGGGAGACAGCTGCAGGGGATGG + Intergenic
939605081 2:144244494-144244516 GGAGAAACAACAGTTGGGGGAGG + Intronic
939664844 2:144938337-144938359 GGGGGAACAGCAGAGTGTGATGG + Intergenic
940107566 2:150116245-150116267 ATGGAAAGAGCAGTGGGGAAAGG - Intergenic
940478169 2:154192428-154192450 GGTGATACAGGAGTGGGGCAGGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940709458 2:157144381-157144403 GGGGAAACACCACAGGGAGAAGG - Intergenic
940897981 2:159099306-159099328 AGAGATACAGCAGTGAGGGAGGG - Intronic
941063308 2:160872491-160872513 TGGGTAACAGCAGTGGAGGTAGG + Intergenic
941587001 2:167372456-167372478 GGGGGAATAGAAGTGGTGGAAGG - Intergenic
941747130 2:169098648-169098670 GGGAAAACATCTGTGGGGCAGGG - Intergenic
941884910 2:170517863-170517885 GGAGAAAAGGCAGTGGGGGAAGG + Intronic
941890388 2:170574907-170574929 GGGGAAAGAGAAGAGGGAGAGGG - Intronic
942298067 2:174536463-174536485 GTGCAGCCAGCAGTGGGGGATGG + Intergenic
942487977 2:176459242-176459264 GGGGAAGAAGCAGTGGGGTCGGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943345695 2:186734761-186734783 TGGGAAACAGCAGAGGCTGAGGG - Intronic
943368359 2:186985637-186985659 GGGGTAACAAGAGTGGGGCAAGG - Intergenic
944636243 2:201678533-201678555 GGTGAAATAGCTCTGGGGGATGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945116134 2:206409868-206409890 TGGGAAACTGCAGGGGGGCAGGG + Intergenic
945204278 2:207315141-207315163 AGGGAAGAAGCAGTGGGGGCTGG + Intergenic
945761429 2:213920495-213920517 GAGGAAGCTGCAGTGGGGGTAGG + Intronic
946342345 2:219078737-219078759 GGTGGGACAGCAGTGGGGAATGG - Intronic
946350331 2:219146897-219146919 GGGCAAAAAGTAGTGGGAGAGGG + Intronic
946375117 2:219303117-219303139 GGGCAAACAGGAGCAGGGGAAGG + Intronic
946538432 2:220657563-220657585 GGGGAGCCGGAAGTGGGGGATGG + Intergenic
946784480 2:223228209-223228231 GGGGAAGAGGGAGTGGGGGAAGG - Intergenic
947548493 2:231029363-231029385 AGGGAAACTACAGTGGGGAAAGG + Intergenic
947770766 2:232668425-232668447 GAGGAAACAGCTCTGGGGAAGGG + Intronic
947808261 2:232983174-232983196 GGGGAGCCAGCAGTGGGGAGGGG + Intronic
947934406 2:233991122-233991144 GAGGAATCAGCAGCCGGGGAGGG + Intronic
948278520 2:236728590-236728612 GGGGTGACAGCAGTGAGGTAGGG - Intergenic
948497163 2:238358571-238358593 GGGGGAACAGGACTGGGGCAGGG - Intronic
948742728 2:240058120-240058142 GAGGAGAAGGCAGTGGGGGAGGG + Intergenic
948863116 2:240762539-240762561 GTGGAAGCAGCATTGGGGGAGGG - Intronic
1169284590 20:4297480-4297502 GGGGAGAAGCCAGTGGGGGAGGG - Intergenic
1169888591 20:10429552-10429574 GGTGGAACAGCAGTTTGGGAGGG - Intronic
1170213559 20:13869106-13869128 GAGGAAAGAGCAGTGGGCCATGG - Intronic
1170513185 20:17100425-17100447 GGAGAAAATGCAGTGGCGGAAGG - Intergenic
1170579527 20:17687332-17687354 GGGGAAACAGCTTTAGAGGAGGG + Intergenic
1170702414 20:18715181-18715203 GGGGGAAATGGAGTGGGGGAGGG - Intronic
1171152705 20:22842047-22842069 TGGGAGACAGCAGTTGGGGTGGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171750322 20:29043065-29043087 GAGGAAGCTGCAGTGGGTGAAGG + Intergenic
1172204457 20:33153038-33153060 GAGAAAGCAGGAGTGGGGGAAGG - Intergenic
1172740707 20:37164321-37164343 GGAGAAAGAGGAGTGAGGGAAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172980443 20:38937576-38937598 TGGGACACAGGAATGGGGGATGG + Intronic
1173082097 20:39877964-39877986 GTCTGAACAGCAGTGGGGGAAGG - Intergenic
1173154565 20:40596758-40596780 GTGGAAAGGGCAGTGGGAGAAGG - Intergenic
1174184789 20:48698700-48698722 GGGGAAAGGGCAATGGGGAAGGG + Intronic
1174267293 20:49341096-49341118 GGGGAGAGGGAAGTGGGGGAGGG - Intergenic
1174284164 20:49460502-49460524 GGGGAAACAGCAGGAGGGAGAGG - Intronic
1174301341 20:49584775-49584797 GGGGAGAAAGCAATGGAGGAGGG + Intergenic
1174548077 20:51341597-51341619 GTAGAAAGAGCAGTGGGGGTTGG - Intergenic
1175012615 20:55754700-55754722 GGTGAAAGAAGAGTGGGGGAAGG + Intergenic
1175057274 20:56209686-56209708 GTGGAATAAGGAGTGGGGGAAGG + Intergenic
1175285831 20:57836209-57836231 TGGGAGACAGCAGAGGGCGAGGG + Intergenic
1176125509 20:63472936-63472958 GGGGAGACAGGAGTGGAGGGGGG + Intergenic
1176314891 21:5232852-5232874 GAGGAAGCTGCAGTGGGTGAAGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177360729 21:20065674-20065696 GGAGTAACAGCAGTTGGGGCTGG + Intergenic
1177403095 21:20631663-20631685 GGGGAAACAGAAGTTTGTGATGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178153183 21:29819858-29819880 GGTGAAAGTGCAGTGGGGGTGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179268931 21:39833232-39833254 GGGGAAACAGGAGCCGGGGAAGG - Intergenic
1179406190 21:41127823-41127845 GGGGAAGGAGGGGTGGGGGATGG - Intergenic
1179629736 21:42668996-42669018 GGGGAAACTTCAGGAGGGGATGG - Intronic
1179913243 21:44461077-44461099 TGGGGTCCAGCAGTGGGGGATGG + Exonic
1179948715 21:44697830-44697852 GGGGACACAGCAGGAGGGGACGG - Exonic
1180392685 22:12298806-12298828 GAGGAAGCTGCAGTGGGTGAAGG - Intergenic
1180407064 22:12565962-12565984 GAGGAAGCTGCAGTGGGTGAAGG + Intergenic
1180626070 22:17194345-17194367 GGGGAGACAGGAGTGAGGCAAGG - Intronic
1181387899 22:22558344-22558366 AGGGAGACAGAAGGGGGGGAGGG + Intronic
1181557225 22:23678067-23678089 AGGGAAACAGCAGAGGGGCTGGG - Intergenic
1181588384 22:23867086-23867108 GGGGCAAAAGCAGGGTGGGAGGG + Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1181637817 22:24182383-24182405 GGGGTCCCAGCAGTGGGGAAAGG - Intronic
1181697155 22:24599493-24599515 AGGGAAACAGCAGAGGGGCTGGG + Intronic
1181714074 22:24711699-24711721 GGGGGAAGAGCAGTGGGAGATGG + Intergenic
1181801067 22:25348310-25348332 GGGGACATAGGAGTAGGGGAGGG + Intergenic
1182073113 22:27477147-27477169 GGGGAATTAGGGGTGGGGGAAGG + Intergenic
1182143284 22:27980979-27981001 GTGGCTTCAGCAGTGGGGGAGGG + Exonic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182524699 22:30907917-30907939 GGTGAAACAGCAGGGGGGTCAGG + Intergenic
1182549475 22:31093230-31093252 GTGGAAGGGGCAGTGGGGGAGGG - Intronic
1182782784 22:32881223-32881245 GAGGAGAGAGGAGTGGGGGAAGG + Intronic
1183186399 22:36293898-36293920 GGGGCAGGAGCAGTGGGGGTGGG - Intronic
1183371002 22:37432386-37432408 AGGGAGACTGAAGTGGGGGAGGG - Intergenic
1183386000 22:37514984-37515006 GGCGGAACAGCAGCGTGGGAAGG + Intronic
1183471008 22:38006700-38006722 GGGGAGGCAGCAACGGGGGAAGG + Intronic
1183666442 22:39248959-39248981 GTGGCCACAGCCGTGGGGGATGG + Intergenic
1184274184 22:43400735-43400757 GGCGACAGAGGAGTGGGGGATGG + Intergenic
1184668825 22:46002251-46002273 GGGGAAGGAGCAGTGGGGGGAGG + Intergenic
1184762261 22:46551324-46551346 GGAGAGACGGCAGTGGAGGAGGG - Intergenic
1185020467 22:48371755-48371777 GGGGAAATAACAGTGGCTGATGG - Intergenic
1185114418 22:48923451-48923473 GAGAACGCAGCAGTGGGGGAAGG - Intergenic
1185227631 22:49661817-49661839 GTGGAAACAGCCGTGGAGGTGGG + Intergenic
1185345971 22:50310967-50310989 GGGGACACAGGGCTGGGGGAGGG - Exonic
949315809 3:2753532-2753554 AAGGATACAGCAGTGGGAGAAGG + Intronic
949723394 3:7016432-7016454 GGGGAAACAGAAATTGAGGAGGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949881360 3:8663548-8663570 GGGGCCACAGCAGTGGGGCGGGG + Intronic
950005543 3:9688887-9688909 GGGGGACCAGTAGTGGGAGAAGG + Intronic
950016292 3:9757194-9757216 GGGGAGAGAGAAGTGGGGAATGG - Intronic
950139673 3:10606803-10606825 GGGGATACAGCAGTGACTGAGGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952297117 3:32071383-32071405 ATGGAAACAGGAGTGGGGAAAGG - Intronic
952316828 3:32238874-32238896 GGGGACACAGGCGCGGGGGAGGG - Exonic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953110823 3:39936411-39936433 GAGGAAACAGGAATGGGAGAAGG + Intronic
953162039 3:40429938-40429960 GGAGTAACACCAGAGGGGGAAGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953844783 3:46418686-46418708 GGGGTAATAGCACTGTGGGATGG - Intergenic
954161541 3:48726387-48726409 ATGGAAACAGGAGTGGGGAAAGG + Intronic
954459365 3:50617572-50617594 GGTGAAACAGCAGAGGAGCAGGG + Exonic
954509125 3:51106385-51106407 GGGGAGGCTGCAGTGGAGGAAGG - Intronic
954560838 3:51555231-51555253 GGGTCAACTACAGTGGGGGAGGG - Intronic
954619103 3:51985672-51985694 CAGGAGACAGCAATGGGGGATGG + Intronic
954671555 3:52293897-52293919 AAGGAAACAGCACTGGGGGGTGG - Intergenic
954904474 3:54048404-54048426 GGTGAAACAGCTGTTGGAGATGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955916689 3:63913522-63913544 GGAGAAACAGGAGTAGAGGAAGG + Intronic
956414820 3:69014350-69014372 GAGGAAAAGACAGTGGGGGATGG - Intergenic
956548776 3:70436930-70436952 ATGGAAACAGGAGTGGGGAAAGG + Intergenic
956798973 3:72739769-72739791 AAGGAAACAGGAGTGGGGCAGGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959612717 3:108313303-108313325 GTGAAACCAGCAGTGAGGGAAGG + Intronic
959963938 3:112333064-112333086 GGGGAAAACGGAGTGGGAGAAGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960124019 3:113978055-113978077 GGGGAAACACCAGTCAGGGGTGG - Intronic
960521613 3:118661808-118661830 GGGGGTAAAGCAGTGTGGGAGGG + Intergenic
960740671 3:120830153-120830175 AGGGAATCAGAAGTGTGGGATGG + Intergenic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961329975 3:126132596-126132618 GGAGAAACAGGAGTGTGGAAAGG - Intronic
961602986 3:128075505-128075527 GGGGAAGGAGCAGTGGGGGAAGG - Intronic
961742148 3:129039685-129039707 AGGGAAACAGCAGGCAGGGAGGG - Intronic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
961933136 3:130554798-130554820 TGGGAGGCTGCAGTGGGGGAGGG + Intergenic
962315290 3:134355529-134355551 GTGGGAAAAGGAGTGGGGGAAGG + Intergenic
962655750 3:137542558-137542580 GGGGAGGCTGCAGTTGGGGAAGG + Intergenic
962710622 3:138082704-138082726 AAGGAGACAGCAGTGGGGAATGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963086895 3:141445353-141445375 GGAGACAAAGCAGTGGGGGCTGG + Exonic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963914023 3:150841249-150841271 GGGGAAACTGCAGTGTTGGGAGG + Intergenic
964012063 3:151903335-151903357 GGGGAGACAATGGTGGGGGAAGG + Intergenic
964481998 3:157148722-157148744 GGGCATACAGCAGTGAGGGGTGG - Intronic
964690155 3:159441480-159441502 GGGGTGACAGGAGTGGGGAAGGG + Intronic
965805049 3:172533695-172533717 GGGGAAGCTGCAGTCTGGGAAGG + Intergenic
965857099 3:173102520-173102542 GGGGAAACACGGGTAGGGGAAGG + Intronic
966240799 3:177753589-177753611 GGGGAAACAGGAGTGAGGGCAGG + Intergenic
966289905 3:178343470-178343492 GGGGAAACTGCAGTACGGGGAGG - Intergenic
966559195 3:181300095-181300117 GGGGAAGGAGGAGTAGGGGAAGG + Intergenic
967190050 3:186977234-186977256 GGGGGAGAAGCCGTGGGGGAGGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968534348 4:1113820-1113842 GGCGCGACAGCAGTGGGGGAGGG + Intergenic
968552598 4:1231377-1231399 GGGGACACATCAGTGGGTGTTGG - Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969158672 4:5235957-5235979 GGGGGACCAGCAGGAGGGGATGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969184310 4:5464093-5464115 GCAGGAACAGCAGTGGGGGTGGG + Intronic
969643881 4:8415035-8415057 GGGGAAAGTGCAGTGTGGCAGGG - Intronic
969836240 4:9844289-9844311 GGAGAAAAATGAGTGGGGGAAGG - Intronic
970402839 4:15734571-15734593 GAGAAAACAGGAATGGGGGAGGG + Intronic
970600416 4:17637321-17637343 GCTGAAAAAGCAGTGGGGGCCGG - Intronic
971184562 4:24361120-24361142 GCGGCAACAGCAGAGGGGCAGGG + Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972043386 4:34632871-34632893 GGGGAAAAAGCAGTGAGGTGGGG + Intergenic
972645329 4:40962709-40962731 GAGGACAAAGAAGTGGGGGAAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973785234 4:54326525-54326547 GGGGAGACAGGAGAGGGAGAGGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975122230 4:70741118-70741140 GGGGAAGGAGAATTGGGGGAGGG + Intronic
975170612 4:71228101-71228123 GGAGAAAGTGCTGTGGGGGAGGG - Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976753854 4:88477533-88477555 GGGGAAGGGGAAGTGGGGGAGGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977514997 4:98011101-98011123 GGGGATAGAGCACAGGGGGAGGG - Intronic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978904852 4:113993839-113993861 GGAGAAACAGGACTGGAGGAGGG + Intergenic
979238800 4:118430374-118430396 GATGAGACAGCACTGGGGGATGG + Intergenic
979239354 4:118434770-118434792 AGGGAAACAGCAGGGTGAGATGG + Intergenic
979546246 4:121943231-121943253 GTGGAAGAAGCAGTGGTGGAGGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980748376 4:137053282-137053304 GGAGAAAAAACAGTGGGGAATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980906628 4:138954467-138954489 GGAGAAAAAGCAGTGCGGGATGG - Intergenic
982070193 4:151687737-151687759 GGTGAAACAGGAAGGGGGGAGGG - Intronic
982102065 4:151977707-151977729 GGGGAAACAGGAATTAGGGAGGG + Intergenic
982106725 4:152017758-152017780 GGGGAGACAGCAGAGGGGGCCGG + Intergenic
982965862 4:161906619-161906641 GGGGAAACTGAAGTGAGGGAGGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984423189 4:179551092-179551114 GGGGAAACAGCAGTGGTCCTGGG + Intergenic
985023566 4:185716826-185716848 GAGGAAACATCAGTGGAGGGAGG + Intronic
985493055 5:190310-190332 AGAGAAACAGCAGTGGGAGGGGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986685541 5:10272715-10272737 GTGGCAACCGCAGAGGGGGACGG - Intergenic
986773542 5:10994436-10994458 GGGGAAAGAGGAGCGGGGGCCGG + Intronic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987205864 5:15624976-15624998 TGGGAAAAAGCAGGAGGGGAGGG - Intronic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988864946 5:35324474-35324496 GGGGAAGCTGCAGTGTGGGGTGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989086838 5:37685333-37685355 GGGGAAGCTGCAGTGAGGGGAGG + Intronic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990761938 5:59139311-59139333 GAGGAAACAGAAGATGGGGAAGG + Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991045797 5:62221506-62221528 GGGGATACAGCACTGGGGCCAGG - Intergenic
991066221 5:62427725-62427747 GGGTAAAGGGCAGGGGGGGATGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991562846 5:67972666-67972688 AGGGAAACAGAGGTGGGGGGAGG + Intergenic
991772557 5:70053350-70053372 CAGGAAACAGCACTTGGGGATGG + Intronic
991851850 5:70928774-70928796 CAGGAAACAGCACTTGGGGATGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992893882 5:81230657-81230679 GGGGAAACTGCGTTGAGGGAAGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993339745 5:86708708-86708730 GGGGAAAAAAGGGTGGGGGAAGG + Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993806809 5:92420568-92420590 AGGAAAACAGCAGTTAGGGAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995787020 5:115841428-115841450 GGGGAAACTGCAGCGGAAGACGG + Exonic
996018042 5:118562804-118562826 GGGAAAACAGGAGTGGGGAAGGG + Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996954257 5:129164326-129164348 GGGGAAGCTGCAGTGTGGGGAGG + Intergenic
997424905 5:133796513-133796535 GAGGAGCCAGAAGTGGGGGATGG + Intergenic
997436800 5:133881515-133881537 GGGGGCACAGAAGTGGGGGCAGG + Intergenic
997456343 5:134020347-134020369 GGGTAAACAGGAGCTGGGGAGGG - Intergenic
998051676 5:139041206-139041228 GTGGCAGCAGCAGTGGGTGAAGG - Intronic
998071981 5:139205167-139205189 AGGGAAACAGAGGAGGGGGAGGG - Intronic
998358345 5:141560927-141560949 GGGGAAAGATGAGGGGGGGAAGG + Intronic
998906942 5:146915499-146915521 GAAGGAATAGCAGTGGGGGAGGG - Intronic
999019987 5:148154501-148154523 GGGGAAACTGCAGTGGCAGAAGG - Intergenic
999044739 5:148454852-148454874 GGGGCAAGAGCAATGGGGAAGGG - Intronic
999241613 5:150131237-150131259 GGGGATAGGGCAGTGGGGGCTGG - Intronic
1000095449 5:157967370-157967392 GTGGAAAAAGCAGTTGTGGATGG - Intergenic
1000110512 5:158103585-158103607 GAGGAAAGGTCAGTGGGGGAAGG + Intergenic
1000410704 5:160933272-160933294 GGGGTAACACCACTGTGGGATGG - Intergenic
1000486206 5:161847910-161847932 GGGGGAGCGGCAATGGGGGAGGG - Intronic
1000750664 5:165092284-165092306 GGGGCAACAGAGGTGGTGGAGGG + Intergenic
1001133237 5:169081259-169081281 GGGTACACAGCAGGGTGGGAAGG + Intronic
1001401562 5:171449470-171449492 CGGGGAAGAGAAGTGGGGGATGG - Intronic
1002446713 5:179294627-179294649 GGGGAAGCTGCAGTGGGGGCGGG - Intronic
1002454229 5:179337177-179337199 GGGTAACCACCAGTAGGGGATGG + Intronic
1002739597 5:181425350-181425372 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1003162782 6:3650637-3650659 TGGGAAACAGGAGTGGGGCTGGG - Intergenic
1003318549 6:5033077-5033099 GGGGCCACGGGAGTGGGGGAGGG - Intergenic
1003471169 6:6435136-6435158 GGGGAAAGAGTTGAGGGGGAAGG - Intergenic
1003635959 6:7831806-7831828 GGGGAAAGACCACTGGGGGTGGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005268477 6:24138326-24138348 GGGGCAGCAGCAATGGGTGATGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005867794 6:29949239-29949261 GGGGACACACCTGTTGGGGAAGG + Intergenic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007078962 6:39085354-39085376 CGGGAAACAGCAGGGAGGAAGGG - Intronic
1007494853 6:42252663-42252685 GGGGGTTCAGCAGTGGGAGAAGG + Intronic
1007703893 6:43779888-43779910 GGGGAAACAGGAAGGGGGGCAGG - Intronic
1007849622 6:44790872-44790894 GGGGGAAAAGGAGTGGGGAATGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008688032 6:53945908-53945930 GGGGAAGCTGCAGTGGAGGGAGG - Intronic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009458801 6:63888171-63888193 TGGGACAGAGCACTGGGGGAAGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010575891 6:77530623-77530645 GTTGACACAGCAGTGTGGGAAGG + Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011290557 6:85772576-85772598 GGGGAACCTGCAGTGTGGGGAGG + Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011630767 6:89321789-89321811 GTGGAAACTGCAGGAGGGGAGGG + Intergenic
1011786436 6:90850482-90850504 GGGGTAACAGCAGGGGAGGCTGG + Intergenic
1011851744 6:91638061-91638083 GGGGAATCAGCAGTGAAGGGTGG - Intergenic
1012218088 6:96613472-96613494 GGTGACACAGCAGTGGGGGCAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013068380 6:106705456-106705478 GGGAAAACAGGAATGAGGGAGGG + Intergenic
1013682643 6:112541866-112541888 TGGGACAGAGCACTGGGGGAAGG + Intergenic
1013755075 6:113451950-113451972 GGGAAAACAGGAATTGGGGAGGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014795688 6:125721636-125721658 CGGGAAACAGCAGGCTGGGATGG + Intergenic
1015005890 6:128281384-128281406 GGAGAAAAAGGAGTGCGGGAAGG - Intronic
1015045714 6:128774084-128774106 GGGGACACAGGAGTGGGTGAAGG - Intergenic
1015403057 6:132808696-132808718 GGGGAAGCAGCAGAGAGGGCTGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016009906 6:139128758-139128780 GTTGAAACAGCAGTGTGGAAAGG + Intergenic
1016361590 6:143273463-143273485 GGGGACACAGCAGAGGTGAATGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017907749 6:158768515-158768537 GGAGAAGCCACAGTGGGGGAAGG + Intronic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018348820 6:162933898-162933920 GGGGAAACAAGAGAGAGGGAAGG + Intronic
1018414538 6:163590087-163590109 GGGGAAATAGCTGAGGGGAAGGG - Intergenic
1018525997 6:164710518-164710540 GGGGAGCCGGAAGTGGGGGATGG + Intergenic
1018526015 6:164710579-164710601 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1019002946 6:168770698-168770720 GGGGTAACTGCACTGGGGAAAGG + Intergenic
1019049210 6:169170309-169170331 GTGGGAAGAGCAATGGGGGAGGG - Intergenic
1019244713 6:170700937-170700959 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1019319358 7:408647-408669 GTGGGGACAGCAGTGGGGGTGGG + Intergenic
1019354200 7:570438-570460 GGGGACACAGGAGCGCGGGAGGG - Intronic
1019408590 7:896985-897007 GTGGACACAGCTGTGGGGAAGGG - Intergenic
1019609478 7:1929720-1929742 GGGGACGTGGCAGTGGGGGATGG - Intronic
1019609553 7:1929937-1929959 GGGGACGTGGCAGTGGGGGACGG - Intronic
1019609667 7:1930291-1930313 GGGGACATGGCATTGGGGGATGG - Intronic
1019609731 7:1930456-1930478 GGGGACGTGGCAGTGGGGGATGG - Intronic
1019609742 7:1930484-1930506 GGGGACGTGGCAGTGGGGGATGG - Intronic
1019843401 7:3472984-3473006 GGGGAAAAAGAAGAGGAGGAAGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021024145 7:15643479-15643501 AGGGGAACAGGGGTGGGGGAGGG + Intronic
1021354941 7:19642625-19642647 AGGGAGACAGGAGAGGGGGAAGG + Intergenic
1021858139 7:24878182-24878204 GTGGAAACAGCTGTGCTGGAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022855481 7:34309826-34309848 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023424434 7:40020474-40020496 GGGGGAACAGCAGGAGGGAAAGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024458582 7:49636279-49636301 GGGAAAATTACAGTGGGGGAAGG + Intergenic
1024709723 7:52002049-52002071 TGGGAAACAGCAGGAGAGGAAGG + Intergenic
1025878567 7:65509921-65509943 GGGCAAAAAGCAGTGGGAGCTGG + Intergenic
1026160210 7:67862047-67862069 TGGGAAACAGGAATTGGGGAGGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026946597 7:74320227-74320249 GGAAAAAGAGCAGTGGGGGCCGG + Intronic
1027172389 7:75881937-75881959 GGTGAAGAAGCAGTGGCGGACGG - Exonic
1027591857 7:80128191-80128213 GGGCAAACAACACTGGGGCAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029361971 7:100094360-100094382 GGGGAAGCAGAAGAGGGAGATGG + Intronic
1029530369 7:101121489-101121511 GGGGATACAGCAGGAGAGGAGGG + Intergenic
1029597957 7:101547511-101547533 GGACACACACCAGTGGGGGATGG + Intronic
1029673355 7:102049123-102049145 GGGGACACAGTACTGGGGGCAGG + Intronic
1029745435 7:102513428-102513450 GGGGAAAGAGGGATGGGGGAAGG + Intronic
1029763374 7:102612407-102612429 GGGGAAAGAGGGATGGGGGAAGG + Intronic
1030082896 7:105792479-105792501 GGGGACAAAGCAGGGAGGGAGGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030513609 7:110515482-110515504 GGGGAGCCAGAAGTGGGGGATGG + Intergenic
1030651320 7:112119175-112119197 GTGAAAACAGCAGGGTGGGAGGG + Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032223267 7:130010211-130010233 GTGGAAACAGCAGTGGGGAAAGG + Intergenic
1032513436 7:132490064-132490086 GGGAAAGGAGCAATGGGGGAAGG + Intronic
1032576518 7:133060546-133060568 GGTGAGATAGCAGTGGGGCAGGG + Intronic
1032666580 7:134043071-134043093 AGGGAGACTGCAGTGGGGGAAGG - Intronic
1033311746 7:140266764-140266786 GGGCGAACAGCAGTGGGAGGGGG - Intergenic
1033350744 7:140559746-140559768 GGGAAAACAGAACTGGGGAATGG + Exonic
1033942664 7:146675240-146675262 GGGGAAAAAACAGCGGGAGAAGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034271316 7:149804593-149804615 GAAGAAAGAGGAGTGGGGGAGGG + Intergenic
1034552361 7:151829795-151829817 GGGGACCCTGCAGCGGGGGAGGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1034985512 7:155511130-155511152 TGGGAAACGAGAGTGGGGGAGGG - Intronic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1035379847 7:158430823-158430845 GTGAAAACAGCAGTGAGGAAGGG + Intronic
1035503413 8:107251-107273 AGGGAAACAGCAGGGTGAGATGG - Intergenic
1036070706 8:5438708-5438730 ATGGAAACAGAAGTGGGGAAAGG + Intergenic
1036391041 8:8324518-8324540 GGGGAAGGGGCGGTGGGGGAGGG + Intronic
1036459733 8:8941242-8941264 AGGGAAGCAGCAGTGGCGGGCGG + Intergenic
1036513020 8:9418280-9418302 GGGGAAACAGAGGAGGAGGAGGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037134753 8:15446722-15446744 TGGGAGACAGGAGAGGGGGAGGG + Intronic
1037753219 8:21696053-21696075 GGGGACACAGGAGATGGGGAGGG - Intronic
1038119278 8:24593992-24594014 GGGGATAGAGCAGTGAGAGATGG + Intergenic
1038409062 8:27344166-27344188 GGGGAGAGAGAAGTGGGAGAGGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040909414 8:52502896-52502918 GGGAAAACAGCAATTAGGGAGGG - Intergenic
1041266580 8:56071540-56071562 TGGGTAACAGCAGTAGGGGAGGG + Intronic
1041953878 8:63536272-63536294 CGGGAAGCTGCAGTGGGGAATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042290915 8:67168312-67168334 GGGGAGACGGGAGAGGGGGAGGG + Intronic
1042586843 8:70348996-70349018 GGGGGCATGGCAGTGGGGGATGG + Intronic
1042682381 8:71400026-71400048 TGAGAAACAGCAATGGGGAAAGG + Intergenic
1042792003 8:72618050-72618072 GGAGAAACAGCAGTGTGTGCAGG - Intronic
1043350931 8:79360248-79360270 GGGGAGTCAGAAGTGGGGGATGG + Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044300999 8:90582793-90582815 GGGAAAAAGGGAGTGGGGGAGGG - Intergenic
1044915668 8:97110620-97110642 GAGGACACAGAAGTAGGGGATGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045499818 8:102736659-102736681 GGGGAAACAGGAATTAGGGAGGG - Intergenic
1045544281 8:103114102-103114124 GGGGAACCAGCAGAAGGGGATGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045949024 8:107830546-107830568 AGGGAAACAGAATTGGGAGAAGG - Intergenic
1046099059 8:109593831-109593853 GGGTGAAAGGCAGTGGGGGAAGG - Intronic
1046637776 8:116691346-116691368 GGGGGAAGAGGAGTGGGGGGAGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048416260 8:134230742-134230764 GGGGAAACACCAGTCAGGGTTGG - Intergenic
1048589276 8:135806073-135806095 TGGGAAACAACAGCAGGGGAGGG + Intergenic
1049197249 8:141322680-141322702 TGGGAAAGAGCAGGTGGGGAGGG - Intergenic
1049265546 8:141666065-141666087 GGGGAGGCAGCAGCGTGGGAAGG - Intergenic
1049339266 8:142103248-142103270 GGGGAGACAGCACTGGGTGGAGG + Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050118876 9:2288130-2288152 GGGAAAGCGGAAGTGGGGGATGG - Intergenic
1050295785 9:4203960-4203982 GGGGAAAGAGAAATGGGGCAAGG + Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051487776 9:17626929-17626951 AGGGAACCAGTAATGGGGGAGGG - Intronic
1051606991 9:18926163-18926185 GGGGAAATATCAATGGGGGAAGG + Intergenic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051663952 9:19450830-19450852 TGGGAAACTGCAGGGGGGCAGGG - Exonic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052999352 9:34568988-34569010 GGAGAAACCGGGGTGGGGGAGGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053542963 9:38993736-38993758 GGGGAGACTGCAGTGGGGGCAGG + Intergenic
1053721409 9:40950754-40950776 GAGGAAGCTGCAGTGGGTGAAGG + Intergenic
1053807406 9:41817253-41817275 GGGGAGACTGCAGTGGGGGCAGG + Intergenic
1053946268 9:43312311-43312333 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1054344589 9:63901414-63901436 GAGGAAGCTGCAGTGGGTGAAGG - Intergenic
1054407604 9:64774683-64774705 GGGCAAACAGCCGCGGGGGCGGG + Intergenic
1054407615 9:64774707-64774729 GGGCAAACAGCCGCGGGGGCGGG + Intergenic
1054623186 9:67370174-67370196 GGGGAGACTGCAGTGGGGGCAGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056386357 9:86099833-86099855 GGGGAAGCGGCTGTGGGGAAAGG + Intronic
1057144487 9:92748994-92749016 GGGGTAACAGGAGAGGGGGCAGG + Intronic
1057269934 9:93645021-93645043 GAGGAAGCAGCAGAGGGGCAGGG - Intronic
1057489681 9:95511234-95511256 GGGGAAACCGCCGGGGAGGAAGG - Intronic
1059381950 9:113933827-113933849 GGAGGGATAGCAGTGGGGGAGGG + Intronic
1059641332 9:116219717-116219739 GAGGAAACAGGAGGGAGGGAAGG - Intronic
1060347262 9:122828139-122828161 GGGGACACAGCAGCGGCGGAGGG + Intronic
1060523225 9:124306109-124306131 GGGGCTACAGCACTGGGGGCTGG + Intronic
1060585570 9:124783174-124783196 GCAGAAAAAGCAGTGGGGGCAGG + Intronic
1060757602 9:126224404-126224426 GGGGAACCAGCCTGGGGGGATGG - Intergenic
1060819842 9:126654967-126654989 GGTGTCACAGCTGTGGGGGATGG - Intronic
1061120693 9:128640634-128640656 GAGGAGACAGAAGTGGGGCAGGG + Intronic
1061613497 9:131763850-131763872 GAGGAAGCAGCAGTGGCTGAGGG - Intergenic
1061644538 9:131990111-131990133 GGGGAAGCAGTGGTGGGGGTGGG - Intronic
1061670991 9:132188138-132188160 GGGGAAGCAATCGTGGGGGAAGG - Intronic
1062208785 9:135351932-135351954 GGGGCCACATCAGTCGGGGAGGG - Intergenic
1203453780 Un_GL000219v1:145392-145414 GAGGAAGCTGCAGTGGGTGAAGG - Intergenic
1203589398 Un_KI270747v1:40869-40891 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1203604903 Un_KI270748v1:50157-50179 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1185459906 X:329021-329043 GGGGAGAGAGGAGAGGGGGACGG - Intergenic
1185459914 X:329042-329064 GGGGAGAGAGGAGAGGGGGACGG - Intergenic
1185763681 X:2707660-2707682 GTGGAAACAGCAGTGGCAGTTGG + Intronic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1186410576 X:9342218-9342240 GGGTGAAAAGCAGAGGGGGAGGG - Intergenic
1186410591 X:9342255-9342277 GGGTAAAAAGCAGAGGGGGAGGG - Intergenic
1186410612 X:9342306-9342328 GGGGTGAAAGCAGCGGGGGAGGG - Intergenic
1186410625 X:9342339-9342361 GGGGTGAAAGCAGAGGGGGAGGG - Intergenic
1186410638 X:9342374-9342396 GGGTAAAAAGCAGAGGGGGAGGG - Intergenic
1186530514 X:10290573-10290595 GGGGAACCAGCAATGAGGCAGGG + Intergenic
1186615794 X:11186921-11186943 TGGGAAACACCTGTAGGGGAGGG + Intronic
1187149534 X:16669082-16669104 GGAAAAGCAGCAGTGGGGGGTGG + Intronic
1187219274 X:17308133-17308155 GGGGAAACACCACAGGGAGAAGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188527272 X:31099922-31099944 GAGGAAACAGCTGTCGGGGAAGG - Intronic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1189994991 X:46629585-46629607 TGGGAAACAGCAAAGGGGGTGGG + Intronic
1190180183 X:48185262-48185284 GGTGAAACAGTTGTGGGGAAGGG - Intergenic
1190189865 X:48268259-48268281 GGGGAAACAGTTGTGGGGAAGGG + Intronic
1190193198 X:48294485-48294507 GGTGAAACAGTTGTGGGGAAGGG - Intergenic
1190197090 X:48328948-48328970 GGTGAAACAGTTGTGGGGAAGGG + Intergenic
1190199167 X:48345465-48345487 GGGGAAACAGTTGTGGGGAAGGG - Intergenic
1190658609 X:52634759-52634781 GAGGAAACAGTTGTGGGGAAGGG + Intergenic
1190665935 X:52695933-52695955 GGTGAAACAGTTGTGGGGAAGGG - Intronic
1190673483 X:52762477-52762499 GGTGAAACAGTTGTGGGGAAGGG + Intronic
1190677028 X:52791248-52791270 GGTGAAACAGTTGTGGGGAAGGG + Intergenic
1190705109 X:53020957-53020979 GGGGGACCAGCAGTGAGGGATGG - Intergenic
1190737717 X:53266775-53266797 GAGGAGACAGCAGTGGGGATGGG + Intronic
1190738249 X:53269881-53269903 GGAGGAAAAGCAGTGGGGGTGGG - Intronic
1190862520 X:54358080-54358102 GGGAGAACAGAAGAGGGGGAGGG + Intronic
1191055236 X:56233439-56233461 GGGGTTTCAGCAGTGGGGGCGGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191207907 X:57853667-57853689 GGGGAAGCAGCAGTGGGGTGAGG + Intergenic
1191825796 X:65363539-65363561 ACGGAAACAGGAGTGGGGAAAGG - Intergenic
1192214875 X:69151021-69151043 GGGGAAGGGGCAGTGGGAGAGGG + Intergenic
1192218236 X:69178802-69178824 GGGGAAACTGGAGAGGGAGAGGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192491454 X:71579666-71579688 TGGGAGACAGGAGTGGGGTAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192923069 X:75728503-75728525 ATGGAAACAGCCCTGGGGGATGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193018822 X:76767717-76767739 GGGGAAAAAGTGATGGGGGAGGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193300354 X:79881600-79881622 AGGGAAGCAGCAGTGGGTAAAGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193492430 X:82165923-82165945 AGGGAAGCTGCAGTGAGGGAAGG - Intergenic
1193699548 X:84744579-84744601 GGGGCAACGGTTGTGGGGGAAGG - Intergenic
1194344888 X:92751213-92751235 GGGGAGGCTGCAGTAGGGGAGGG + Intergenic
1194736638 X:97520046-97520068 TGGGAAAAAGCAGGGGGGTAGGG - Intronic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195202863 X:102566493-102566515 TGTGAAAGAGCAGTGGGGAAAGG - Intergenic
1195236650 X:102906116-102906138 TGGGACACAGCACTAGGGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195533334 X:105982457-105982479 GGGGAAGCTGCAGTGGGGAGAGG + Intergenic
1195541508 X:106068123-106068145 GGGGAAGCTGCAGTGTGGGGAGG + Intergenic
1195586095 X:106566904-106566926 GGGGAGGCTGCAGTAGGGGAAGG - Intergenic
1195981128 X:110579693-110579715 GGTAAAACAGCAATAGGGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196618583 X:117795995-117796017 GGGGAAAGAGCAGTGGGAAGTGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196951752 X:120931529-120931551 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196952436 X:120936390-120936412 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196953121 X:120941251-120941273 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196953806 X:120946111-120946133 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196954491 X:120950972-120950994 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196955174 X:120955832-120955854 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196955861 X:120960715-120960737 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196956543 X:120965576-120965598 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196957225 X:120970436-120970458 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196957907 X:120975296-120975318 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196958589 X:120980156-120980178 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1196959270 X:120985016-120985038 GGGGCAGCAGCAGCGGGGGGAGG + Exonic
1197378865 X:125713904-125713926 GGGGAAGCTGCAGTGTGGGAAGG - Intergenic
1197777111 X:130125632-130125654 AGGGAAGGGGCAGTGGGGGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198129577 X:133680266-133680288 AGGGATACAGCAGTTGGGGTTGG - Intronic
1198253909 X:134908456-134908478 AGGGAAACAGAAGGAGGGGAGGG - Intronic
1198594855 X:138225071-138225093 AGGGAAAGAGCAGTGGGGTCAGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199923702 X:152439045-152439067 AGGGAAACTGGGGTGGGGGATGG + Intronic
1200048413 X:153414990-153415012 CGGGAAACAGCAGCTGGGGCCGG + Intergenic
1200653229 Y:5867855-5867877 GGGGAGGCTGCAGTAGGGGAGGG + Intergenic
1200797106 Y:7350882-7350904 GGTGACAGAGAAGTGGGGGAGGG - Intergenic
1201395111 Y:13539439-13539461 GGGGAAGCTACAGTTGGGGAAGG - Intergenic
1201524709 Y:14919442-14919464 GGAGAAACAGGAGAGAGGGAGGG + Intergenic
1202018558 Y:20437854-20437876 GTTGAAAGGGCAGTGGGGGATGG + Intergenic