ID: 920029727

View in Genome Browser
Species Human (GRCh38)
Location 1:203029239-203029261
Sequence GCAACCTCGGGGCCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920029718_920029727 16 Left 920029718 1:203029200-203029222 CCCAGCTCATTGCTCTGCCTTCA 0: 1
1: 0
2: 3
3: 35
4: 349
Right 920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
920029723_920029727 -1 Left 920029723 1:203029217-203029239 CCTTCAGAGAGGCTCGGGTGCTG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
920029719_920029727 15 Left 920029719 1:203029201-203029223 CCAGCTCATTGCTCTGCCTTCAG 0: 1
1: 0
2: 3
3: 33
4: 298
Right 920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920029727 Original CRISPR GCAACCTCGGGGCCTCCTTG AGG Intronic
900106087 1:981731-981753 GCCACCTCGGGCCGTCCTCGAGG + Intronic
901027137 1:6284704-6284726 GCAGCATCGAGGCCTCCCTGGGG + Intronic
904826238 1:33275764-33275786 GCAGCCTGGGGCCCTCCTGGGGG + Intronic
905199613 1:36307003-36307025 GGGACCTCGGGGCCGCCCTGCGG + Intronic
906675257 1:47688602-47688624 GAAACATCGAGGCCTTCTTGAGG - Intergenic
914994240 1:152527435-152527457 CCAACATTGGGGCCTACTTGAGG - Intronic
915530860 1:156501241-156501263 GCCACCTCGGCACCTCCTCGCGG + Intergenic
920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG + Intronic
920385995 1:205570186-205570208 GCCACCTCCGGGCTCCCTTGTGG + Intronic
922641412 1:227235634-227235656 GCTACCTCTCAGCCTCCTTGAGG + Intronic
923653469 1:235895270-235895292 ACAAACACGGGGCCTACTTGAGG - Intergenic
1066681155 10:37937870-37937892 GGAAGCCCGGGACCTCCTTGAGG + Intergenic
1070789608 10:79181446-79181468 GCAACCCCAGCACCTCCTTGGGG + Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076560159 10:131357520-131357542 TCAAACCCGGGGCCCCCTTGTGG - Intergenic
1076713690 10:132352745-132352767 GCAGCCCCGAGGCCTCCCTGTGG + Intronic
1084463413 11:69308730-69308752 GCAGCCACGAGGCCTGCTTGAGG + Intronic
1090502592 11:127275949-127275971 GGCACCTCTGGGCCTGCTTGCGG + Intergenic
1092333523 12:7607309-7607331 GCACCAGCGGGGCCTGCTTGAGG - Intergenic
1100793415 12:98155023-98155045 GTAACCACGGCCCCTCCTTGTGG + Intergenic
1101440894 12:104703663-104703685 GAAAGCTCAGAGCCTCCTTGTGG + Intronic
1104732361 12:131114827-131114849 GCTACCTTGTGGGCTCCTTGAGG - Intronic
1114534804 14:23416114-23416136 TCACCCTCAGGGCCTCGTTGCGG + Exonic
1115501354 14:34052774-34052796 GCAACCACAGGGCCTGTTTGTGG + Intronic
1122120877 14:99552787-99552809 GGAAGCTCGTGGCCCCCTTGCGG - Intronic
1128075413 15:64822595-64822617 GCCACCTTGGGGCTTCCTGGGGG + Exonic
1129389778 15:75214715-75214737 GGAAGCTGGGGGCCTCCTTGAGG + Intergenic
1136991900 16:35157802-35157824 CCAGCCTCGGTGCCGCCTTGCGG - Intergenic
1139599178 16:67976350-67976372 GCAACCTTGGAGGCTCCTGGAGG + Intronic
1141254603 16:82389107-82389129 GAAACCCTGGGGCCTACTTGAGG + Intergenic
1144282611 17:13741814-13741836 GCAATCTCAGGTCCTCTTTGGGG - Intergenic
1145445715 17:23170786-23170808 GCATCCTCAGGAACTCCTTGGGG + Intergenic
1148439337 17:47703502-47703524 GCAGCCTCGGGGGCTCCCAGAGG + Intronic
1151351535 17:73534852-73534874 GCATCTTCTAGGCCTCCTTGTGG + Intronic
1151504177 17:74515564-74515586 CTAACCTCAGGGCATCCTTGGGG - Intergenic
1152057649 17:78043275-78043297 GCAGCCTCGGGGCCACACTGTGG - Intronic
1152573007 17:81128679-81128701 GCAACCTTGGGGCCACCATCAGG + Intronic
1160754716 19:751323-751345 TCACCCTCGGAGCCTCCCTGAGG + Intronic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
925907931 2:8550568-8550590 GTCATCTCGGGGCCTGCTTGGGG + Intergenic
926297863 2:11581592-11581614 GCAACCTGGGGACCTGCTCGTGG + Intronic
927022663 2:19033555-19033577 GCAACCCCATGGCCTTCTTGGGG + Intergenic
928693395 2:33824156-33824178 GCATCCTGGGGGCTTCCTAGTGG + Intergenic
934240933 2:90270222-90270244 GCAACCCCTGGGCCTCCCCGTGG + Intergenic
935395140 2:102599769-102599791 TCAACCTCGAGGCATGCTTGAGG - Intergenic
937308479 2:120886783-120886805 GCAACGTCTGGGGTTCCTTGGGG - Intronic
944116396 2:196191602-196191624 GCAACCTCTTGGCCTCTTTTGGG + Intergenic
944736767 2:202574235-202574257 GCAACCTCTCTGCCTCCCTGTGG + Intergenic
1170941777 20:20854124-20854146 ACAGCCTCGGAGCCTTCTTGGGG + Intergenic
1172111432 20:32547653-32547675 GCAACTTGGGTGCTTCCTTGGGG - Intronic
1174201486 20:48809391-48809413 GCACCCTGGGGGCTTCCTTCTGG + Intronic
1175251990 20:57615437-57615459 GGAACCCCAGGCCCTCCTTGAGG - Intronic
1175263702 20:57690144-57690166 TCAGCCTGGGGGCCTCCATGTGG + Intronic
1176081444 20:63275359-63275381 GCAGCCTGGGAGCCTCCTGGGGG + Intronic
1179659429 21:42865037-42865059 GAAACATAGGGGCCTCATTGAGG - Intronic
1180174812 21:46082374-46082396 GCAACCTCGGGGCTCCCGTCAGG + Intergenic
1182472563 22:30557444-30557466 GCAGCCTTGGGGGCTCCCTGGGG - Intronic
1183200104 22:36380120-36380142 GCAGCCTCCGGGCCTCCTGGGGG - Intronic
1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG + Intronic
1184171694 22:42764005-42764027 GCATTCTCAGGGCCTCTTTGTGG - Intergenic
1184212538 22:43044287-43044309 GCAACCTCGGGGCCTCTACAGGG - Intronic
1185300884 22:50080214-50080236 GCAACCTCGGGGGCCCCTCTCGG + Intronic
1185419380 22:50727035-50727057 GCAAACTAGGGGCCTCATTAAGG - Intergenic
951004792 3:17603389-17603411 GCAACCTCTGGTCATCCTTAAGG + Intronic
953027586 3:39153743-39153765 GCGGCCTGGGGGCCTCCCTGCGG + Intronic
953449248 3:42992360-42992382 GCAATACCAGGGCCTCCTTGTGG + Intronic
953646651 3:44761709-44761731 GCAACATGGCGGCCTCCATGCGG + Exonic
959825143 3:110785062-110785084 ACAACCCTGGGGCCTACTTGAGG - Intergenic
961551831 3:127673842-127673864 GCAGCCTGGAGGCCTCCTTTGGG + Intronic
961904714 3:130251097-130251119 GGAACCTCGGGGCCACCATGAGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968733057 4:2280739-2280761 GCACCCTCGGGCCCTGCCTGTGG + Intronic
969681898 4:8647755-8647777 GCATCCTAGAGGCCCCCTTGCGG - Intergenic
972822323 4:42716034-42716056 GCAACCTAGGTGCTTCCTTAAGG - Intergenic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
980378509 4:131978266-131978288 GCAACTTCAGGGCCTGCCTGGGG - Intergenic
985478315 5:92068-92090 GGACCCTCGGAGCCTCCTAGGGG + Intergenic
987787898 5:22525715-22525737 GCAACTTCGGGCTCTACTTGTGG + Intronic
1002465472 5:179406168-179406190 GCTCCCCCGGGGCCTCCTGGTGG - Intergenic
1003815141 6:9831398-9831420 GCAATCTTGAGGACTCCTTGTGG - Intronic
1005509195 6:26497099-26497121 GCATCCTAGGGGCATCCTAGAGG + Intergenic
1006627765 6:35409719-35409741 ATAACCTCGGGGCCTACTTGAGG - Intronic
1006686097 6:35835441-35835463 GAAACCTTGGGGCCTTTTTGAGG - Exonic
1016411509 6:143788084-143788106 ACAACTTCGGTTCCTCCTTGTGG - Intronic
1019426151 7:977780-977802 GCAGCCCTGGGCCCTCCTTGGGG - Intergenic
1020606925 7:10350599-10350621 ACAACCCAGGGGCCTGCTTGAGG - Intergenic
1026857059 7:73762089-73762111 GCACCCCTGGGGCCTCCTGGGGG - Intergenic
1038075444 8:24067618-24067640 GCAAACACTGGGCCACCTTGAGG - Intergenic
1042102773 8:65291759-65291781 GCAACCTTGTGGCAACCTTGTGG - Intergenic
1049005076 8:139849891-139849913 GCCACCTCAGGGCCTCCTTCAGG - Intronic
1049551704 8:143263029-143263051 GGAACCCCGGGGCCTCCTCTGGG - Intronic
1052360790 9:27554467-27554489 GCAACACCAGGGCCTACTTGAGG + Intronic
1053209007 9:36211747-36211769 GCACCAGCGGGGCCTGCTTGAGG - Exonic
1053785775 9:41651977-41651999 GCCACCTCCGACCCTCCTTGGGG - Intergenic
1054159267 9:61662200-61662222 GCGACCTCCGACCCTCCTTGGGG + Exonic
1054174488 9:61865940-61865962 GCGACCTCCGACCCTCCTTGGGG - Intergenic
1054479041 9:65593205-65593227 GCGACCTCCGACCCTCCTTGGGG + Intergenic
1054663050 9:67714851-67714873 GCGACCTCCGACCCTCCTTGGGG + Intergenic
1060749879 9:126162265-126162287 GCTACCTCAGGGCCTCCATCTGG + Intergenic
1061398051 9:130354201-130354223 GCAACTTGAGGGTCTCCTTGAGG + Intronic
1061949519 9:133928644-133928666 GCAGCCTCGGGGCCTGGGTGTGG + Intronic
1189175231 X:38950039-38950061 GCCTCCTCTGAGCCTCCTTGGGG + Intergenic
1196540745 X:116904061-116904083 GAGACCTCGGGACCTACTTGAGG + Intergenic
1199400139 X:147389524-147389546 ACAACCTGGGTGCCTCCTGGGGG + Intergenic
1200066935 X:153508457-153508479 GCCACCGCGGGGCCTCAGTGGGG + Exonic
1200161180 X:154010488-154010510 GCAATCTCGGGCTCTACTTGTGG - Exonic
1200232869 X:154453254-154453276 CCAACCACGGGGTCTCCTTTTGG - Intergenic
1200709275 Y:6469152-6469174 TCAACCTCAAGGCCTCTTTGGGG + Intergenic
1201024837 Y:9695556-9695578 TCAACCTCAAGGCCTCTTTGGGG - Intergenic