ID: 920029844

View in Genome Browser
Species Human (GRCh38)
Location 1:203030275-203030297
Sequence AGGTGTGAGGTGAGGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 734}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920029834_920029844 9 Left 920029834 1:203030243-203030265 CCTGTGTGACCTCCGAGAGCCCT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG 0: 1
1: 0
2: 12
3: 93
4: 734
920029835_920029844 0 Left 920029835 1:203030252-203030274 CCTCCGAGAGCCCTTCTGAGTCC 0: 1
1: 0
2: 0
3: 14
4: 134
Right 920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG 0: 1
1: 0
2: 12
3: 93
4: 734
920029838_920029844 -10 Left 920029838 1:203030262-203030284 CCCTTCTGAGTCCAGGTGTGAGG 0: 1
1: 0
2: 0
3: 20
4: 186
Right 920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG 0: 1
1: 0
2: 12
3: 93
4: 734
920029833_920029844 29 Left 920029833 1:203030223-203030245 CCACACAGGGTGGGAAGTGGCCT 0: 1
1: 0
2: 1
3: 24
4: 232
Right 920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG 0: 1
1: 0
2: 12
3: 93
4: 734
920029832_920029844 30 Left 920029832 1:203030222-203030244 CCCACACAGGGTGGGAAGTGGCC 0: 1
1: 0
2: 1
3: 13
4: 199
Right 920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG 0: 1
1: 0
2: 12
3: 93
4: 734
920029836_920029844 -3 Left 920029836 1:203030255-203030277 CCGAGAGCCCTTCTGAGTCCAGG 0: 1
1: 0
2: 4
3: 29
4: 257
Right 920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG 0: 1
1: 0
2: 12
3: 93
4: 734

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920029844 Original CRISPR AGGTGTGAGGTGAGGCTGGA TGG Intronic
900389830 1:2429046-2429068 AGGGGGTGGGTGAGGCTGGAGGG + Intronic
900573269 1:3370517-3370539 TGGTGGGTGGTGGGGCTGGAAGG - Intronic
900950244 1:5854590-5854612 AGGTCTGAAGTGAGCTTGGAAGG - Intergenic
901318582 1:8325003-8325025 TGGTGTCATGTGAGCCTGGAAGG + Intronic
901412338 1:9093200-9093222 AGGTGTGAGGTGGGGATTGGGGG - Intergenic
902693271 1:18123802-18123824 AGGTAAGAAGTGAGGCTGGAGGG + Intronic
902784821 1:18726222-18726244 AGAGGTGAGGTGGGGGTGGAGGG - Intronic
903066312 1:20701639-20701661 AGGTGGGTGGGGAGGCAGGAAGG + Intronic
903648188 1:24907210-24907232 CGGGGTGAGGTGGGGGTGGAGGG - Intronic
904424697 1:30415817-30415839 AGGAGGGAGCTGAGGCTGGGAGG - Intergenic
904474877 1:30758274-30758296 AGGATTGAGGTGAGGATGAAAGG - Intergenic
904586071 1:31581349-31581371 AGGTGAGAGGTGATGAGGGACGG + Intronic
904750850 1:32741017-32741039 AGGTGAGAGGTGTGACTGGGAGG - Intergenic
904809531 1:33154322-33154344 AGGTGGCAGCTGAGGCTAGAAGG - Intronic
904825550 1:33271671-33271693 GGGTGTGAGGTGAGTGGGGAGGG + Intronic
905109943 1:35587888-35587910 AGGGGTGAGGTGGGGTGGGAGGG + Intronic
905117499 1:35654974-35654996 GGGTTTGAGGTGAGAATGGAGGG - Intergenic
906108870 1:43310250-43310272 AGGCGGAAGGTGAGGCTTGATGG - Intronic
906552445 1:46676635-46676657 AGGTGTGGGGTGAGAGTGGATGG + Exonic
906781197 1:48574673-48574695 AGGTGGGAGTTGTGGCTGGGAGG - Intronic
906935075 1:50207688-50207710 AGGTGTGAGGTATGGCAGGGTGG + Intergenic
907431663 1:54415642-54415664 TGGTGATAGATGAGGCTGGAAGG + Intergenic
907689593 1:56649234-56649256 TGGTGTGAGATGAGGTTGTAAGG + Intronic
908322478 1:62991730-62991752 AGGTGGGAGGTGGGGGTGGAGGG - Intergenic
909503749 1:76363952-76363974 ATGTGGGAGGTGGGGCTGGTGGG - Intronic
910869841 1:91823118-91823140 AGGTGTTAAGGGAGCCTGGAGGG + Intronic
912227825 1:107755388-107755410 GGGGGTGAGGGGAAGCTGGATGG + Intronic
912473531 1:109922055-109922077 AGGTGAGATGTGAAGCTGGGGGG + Intronic
912570973 1:110620629-110620651 TGGTCTGAGGTGAGGATGCAGGG + Intronic
912690003 1:111797750-111797772 AGGTGGGAGATGAGGCTGGAGGG + Intronic
913446771 1:118958663-118958685 AGGTGGGAGGTGGGGCTGGTGGG - Intronic
914675694 1:149905816-149905838 AGGGGTGGGGTGAGGAAGGAGGG - Intronic
915050054 1:153059345-153059367 AGATGTGATGTGAGGCTGTTGGG - Intergenic
915054668 1:153115302-153115324 AGATGTGATGTGAGGCTGTTGGG - Intergenic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
915847679 1:159285090-159285112 GGGTGTGAGGTGAGTTAGGAGGG + Intergenic
916177889 1:162057746-162057768 AGGCGTGGGGTGAGCATGGAGGG + Intergenic
916179756 1:162073049-162073071 AGGTGTGGGGTTAGGATCGAAGG + Intronic
917453616 1:175167469-175167491 AGTGGTGGGGTGAGGGTGGATGG + Intronic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919796277 1:201323239-201323261 AGGAGGGAGCAGAGGCTGGACGG - Intronic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920377846 1:205518912-205518934 AGGTGGGAGGGGAGGTTGGCTGG + Intronic
921013562 1:211166648-211166670 AGTAGAGAGGTGAGGCTAGAAGG + Intergenic
921056747 1:211548371-211548393 AGGTGTGAGGTGAGGCTGAGAGG + Intergenic
921223108 1:212988360-212988382 AGTTGTGAGCTAAGGCTGGCAGG + Intronic
921330375 1:214029790-214029812 GGGTGTGGGGAGAGGCTGGGGGG + Intronic
921781833 1:219174240-219174262 AGGTGTGTTGTGGGGATGGAGGG - Intronic
921797437 1:219362911-219362933 AGGCATGAGGTCAGGCAGGAAGG + Intergenic
922178069 1:223212540-223212562 TGGTGGGAGGTGGGGGTGGAGGG + Intergenic
922182245 1:223244419-223244441 AGGTGAGAGGTGAGACTTCAAGG + Intronic
922217534 1:223532613-223532635 AGGTATGAGGCCAGGCGGGAAGG - Intergenic
922717075 1:227883324-227883346 AGGGGTGAGGCGAGGCTGGGGGG + Intergenic
922916742 1:229264069-229264091 AGGAGAGAGGTGAGGCGGGCTGG + Intergenic
923041470 1:230322946-230322968 AGGTGTCAGGGGAGGCCGGAGGG - Intronic
923083238 1:230680388-230680410 AAGAGTGAGGTGATGCTGCATGG - Intronic
923153845 1:231258442-231258464 AGGTCTCAGAAGAGGCTGGACGG - Intronic
923338229 1:232987751-232987773 TGGGGTGGGGTGGGGCTGGAAGG - Intronic
923544589 1:234914871-234914893 ACGTGTGAGCTGAGACTTGAAGG + Intergenic
923959335 1:239059059-239059081 GGTTGTGAGGTCAAGCTGGAGGG + Intergenic
1062826177 10:570534-570556 AAGTGTGATGTCTGGCTGGATGG - Intronic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1064221062 10:13440474-13440496 AGCTGTGAGGAGAGGCGGGCGGG - Intronic
1064287292 10:14002964-14002986 TGGGAAGAGGTGAGGCTGGAGGG + Intronic
1066482365 10:35809392-35809414 AGGTGGCAGGTGAGGCTGAAGGG - Intergenic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1067132151 10:43574526-43574548 ACGTGGGAGGTGAGACTGGCCGG - Intronic
1067140307 10:43650572-43650594 GGGTGTGGGGTGAGGGTGAAAGG + Intergenic
1068812310 10:61269879-61269901 AGGTTTGGGGTGGGGCTGGAGGG + Intergenic
1069531891 10:69225801-69225823 AGGTGAGAGGTGAGGTGAGAGGG - Intronic
1069920392 10:71812400-71812422 GGATGTGGGGTGAGGCTGGAAGG + Intronic
1070168017 10:73912489-73912511 AAATGTGAGGTGGGGTTGGAAGG + Intronic
1070366557 10:75742484-75742506 AGGTGTGCTGTGGGGGTGGATGG + Intronic
1072090208 10:92119644-92119666 AGAAGAGAGGTGAGGGTGGAGGG + Intronic
1072892562 10:99337370-99337392 TGGTGAGCGATGAGGCTGGAGGG - Intronic
1073197987 10:101710504-101710526 AGGCTTGAGGGGAGGCTGAAGGG + Intergenic
1074032719 10:109704633-109704655 TAGTGTGAGATGAAGCTGGAGGG + Intergenic
1074115902 10:110457438-110457460 AGGGGTGAGGAGAGGCTGAGGGG + Intergenic
1074729008 10:116348735-116348757 AGCTGCTGGGTGAGGCTGGAAGG - Intronic
1075166052 10:120069420-120069442 AGACTGGAGGTGAGGCTGGAGGG + Intergenic
1075170962 10:120113988-120114010 AAGTGTAATGTGAGGCTGGGAGG - Intergenic
1075498841 10:122953933-122953955 AGCTGTGAGGGGAGGCGAGAGGG - Intronic
1075606112 10:123811289-123811311 TGGGGTGAGGGGAGGCGGGAGGG - Intronic
1075747093 10:124735650-124735672 AGGACTGAAGGGAGGCTGGAAGG - Intronic
1075842255 10:125515093-125515115 ACCTTTGAGGTGGGGCTGGAAGG + Intergenic
1076237829 10:128879536-128879558 AAGAGGAAGGTGAGGCTGGAAGG + Intergenic
1076369930 10:129945790-129945812 AGCTGTATGGTGAGGCTCGAAGG - Intronic
1076494142 10:130885721-130885743 AGGTCTGAGCTGGGGCTGCAGGG - Intergenic
1076621049 10:131788439-131788461 AAGTGCGAGGTGAGGCTGGGAGG - Intergenic
1076705713 10:132300402-132300424 TGGGGTGAGAGGAGGCTGGATGG + Intronic
1076756011 10:132572174-132572196 AGGTGTGCCGAGAGGCTGGCCGG + Intronic
1077037035 11:500222-500244 GGGTCTGTGGTGATGCTGGAAGG + Intronic
1077226341 11:1440539-1440561 TGGGGTGGGGTGAGGGTGGAGGG - Intronic
1077410314 11:2400801-2400823 AGGTTTGTGGTGAGGGAGGACGG + Intronic
1077517489 11:3010635-3010657 GGGTGAGAGGAGAGGCTGGCCGG - Intronic
1077523245 11:3048808-3048830 AGGGGCCAGGTGAGGCTGGCTGG - Intronic
1077530417 11:3092349-3092371 AGGAGTGAGGTGAGGAGCGAGGG + Intronic
1077920365 11:6637507-6637529 AGGTGGGAGATGAGACTGCAGGG - Intronic
1078190988 11:9092059-9092081 AGGTGGGAGGTGGGAGTGGAAGG + Intronic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1078436577 11:11330496-11330518 AGGAGGGAGGGGAGGCTGGCTGG + Intronic
1078484231 11:11706850-11706872 AGGTGTCGTGGGAGGCTGGAAGG + Intergenic
1078866869 11:15306193-15306215 AGCTTTGGGGTGAGGGTGGAAGG - Intergenic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1079120021 11:17675529-17675551 TGGTGTGAGGTGGGGCAGGTGGG - Intergenic
1080418992 11:32093671-32093693 AAGTGAGAGGTGAGAATGGAGGG + Intronic
1081588824 11:44406860-44406882 CAGTGCGAGGTGGGGCTGGAAGG + Intergenic
1083539645 11:63503655-63503677 AGGAAGGAAGTGAGGCTGGATGG + Intergenic
1083599701 11:63939200-63939222 AGGGGTCACGTGAGGCTGGAGGG - Intronic
1083611341 11:64005849-64005871 AGGTGTGAGCTGGGGTTTGAGGG + Intronic
1083681341 11:64353232-64353254 CAGTGTGAGGTGTGGCTGGAGGG + Exonic
1083789806 11:64977125-64977147 AGGTCTGGGCTGAGCCTGGAAGG - Intergenic
1083864289 11:65445399-65445421 AGGTAGGAGGTGAGCCTGGGAGG + Intergenic
1084421645 11:69063472-69063494 AGGGGTGAGCCGAGGCTGGATGG - Intronic
1084889775 11:72230959-72230981 GGGGGTGAGGTGGGTCTGGAGGG - Intronic
1084943477 11:72626567-72626589 AGTCCTGGGGTGAGGCTGGAGGG - Intronic
1085021914 11:73215440-73215462 AGGTGAGAGGTGAGGCAGAGAGG + Intergenic
1085280169 11:75324946-75324968 TGGCGTGAGGTGAGGCAGGGAGG + Intronic
1085473239 11:76771481-76771503 TGGTGGGCAGTGAGGCTGGATGG + Intergenic
1085498917 11:76999611-76999633 AGGAGTGAGGTGGGGCAGGAGGG - Intronic
1085904634 11:80745638-80745660 AGGTGAGAGCTGAGGCTGATGGG + Intergenic
1086141649 11:83506344-83506366 AGGTGTGAGATAATGGTGGAAGG - Intronic
1086928909 11:92670992-92671014 TGGTGTCAGATGAGGCTGGAGGG - Intronic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1089224538 11:116906144-116906166 AGGTGTGAGGTGAATATTGAAGG + Intronic
1089460421 11:118649970-118649992 AGGTGTGATGTCAGGCTGTTGGG + Intronic
1089615835 11:119694263-119694285 AGGAGTGATCTGAGCCTGGATGG + Intronic
1089633260 11:119796504-119796526 GGTTGTGGGGTGGGGCTGGAAGG + Intergenic
1089637380 11:119824067-119824089 AGGACTGAGGTGAGGTAGGAAGG - Intergenic
1089644892 11:119872417-119872439 AGGGGTGAGATGAAGCTGGAGGG - Intergenic
1089646977 11:119886821-119886843 AGGTGTGTGGTGAGGGTGCCAGG + Intergenic
1090068726 11:123525751-123525773 TGGTATGAGGTGAGGGTGGGGGG + Exonic
1090240678 11:125179421-125179443 ATGTTTGAGGTGAGCCTGAAGGG + Intronic
1090611739 11:128477462-128477484 AGGTGGTGGGTGAGGCTGTATGG + Intronic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1091240113 11:134046441-134046463 AGCTGTAACGTGGGGCTGGAAGG + Intergenic
1091253399 11:134163072-134163094 AGGTTAGAGGTGAGGATGGAGGG + Intronic
1091785726 12:3242383-3242405 AGGTGGGAGGTGGGGCTGGCTGG - Intronic
1091855492 12:3736053-3736075 AGGTATGGGGTGAGGCAGGGAGG + Intronic
1091877098 12:3944439-3944461 GGGACTGAGGTGAGGGTGGAGGG - Intergenic
1092119751 12:6035608-6035630 TGGTTTGAGGTGAGGGTGGCTGG - Intronic
1092951726 12:13509809-13509831 TGGTCTTAGGTGAGGTTGGAGGG + Intergenic
1093972044 12:25384552-25384574 TGGTATGAGGTGAGCCTGGAAGG + Intergenic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1095085791 12:38056516-38056538 GGGTGTGGGGTGAGGACGGAGGG - Intergenic
1095420392 12:42018584-42018606 AGGTGTGAGCTGAGTTGGGAGGG + Intergenic
1095441449 12:42242252-42242274 AGCTGAGAGCTGAGGCAGGAAGG + Intronic
1095974669 12:47931072-47931094 AGGTGTAAGCTCAGGCTGGATGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096845055 12:54401904-54401926 AGCTGTGAGGTGCGGAGGGAGGG - Intronic
1096993948 12:55827581-55827603 AGGTGACCGGTTAGGCTGGAGGG - Exonic
1097710291 12:62910194-62910216 AGGAGAGAGGGGAGGATGGAAGG + Intronic
1098035446 12:66297276-66297298 GGGTGTGAGATGAGGCTGGTAGG - Intergenic
1098863547 12:75736426-75736448 ACCAGGGAGGTGAGGCTGGATGG - Intergenic
1098903088 12:76132867-76132889 ATGTTGGAGGTGAGGCTGGTGGG - Intergenic
1100037743 12:90274483-90274505 AGATTTGAGGTGAGGCAGAAAGG + Intergenic
1100390392 12:94141765-94141787 AGGTGGGAAGGGAGGCTGCAGGG + Intergenic
1100615783 12:96230819-96230841 AGGTGTGGGGAAAGTCTGGAGGG + Intronic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101208578 12:102513544-102513566 TGGTGTCAGGTGAGGCTGGCAGG - Intergenic
1101355922 12:103977580-103977602 TGGTGAGAGGTGAGGCTGGATGG + Intronic
1101437647 12:104677818-104677840 TGATATGAGGTGGGGCTGGAAGG - Intronic
1101519518 12:105468525-105468547 AGCTGGGATGTGAGTCTGGAAGG + Intergenic
1102516062 12:113447719-113447741 AAGTTCGAGCTGAGGCTGGAAGG + Intergenic
1102576875 12:113861241-113861263 AGGTCTGAGGTGAAGCAGGAAGG + Intronic
1102596577 12:113997350-113997372 CAGTGTGAGATGAAGCTGGAAGG + Intergenic
1103052310 12:117790869-117790891 AGGTGTGAGGTGAGGGTATTTGG - Intronic
1103261576 12:119593614-119593636 AGGAGTGAGGGGAGGCGGGGAGG - Exonic
1103499226 12:121388038-121388060 GGTTGTGAGGTGAGGGTGGTGGG + Intronic
1103605699 12:122084442-122084464 AGGTTAGAGGAGAGGATGGAGGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1104590300 12:130079401-130079423 AAGAGTGAGATGAGGTTGGAAGG + Intergenic
1104715069 12:131011080-131011102 AGGGGTGAGGTGGGGCAGGGTGG - Intronic
1104715081 12:131011106-131011128 AGGGGTGAGGTGGGGCAGGGTGG - Intronic
1104715093 12:131011132-131011154 AGGGGTGAGGTGGGGCAGGGTGG - Intronic
1104715105 12:131011158-131011180 AGGGGTGAGGTGGGGCAGGGTGG - Intronic
1104849922 12:131867963-131867985 AGGTGTGTGGTGGGCATGGAAGG + Intergenic
1104937500 12:132374390-132374412 AAGTGTGAAAGGAGGCTGGAGGG - Intergenic
1105542479 13:21327144-21327166 AGGTGGGAGGTGGGGTTGGGCGG + Intergenic
1105612160 13:21977925-21977947 AGGGGTGTGGTGAGGATGGGGGG + Intergenic
1105738673 13:23298957-23298979 AGGAGTGTGGTGAGGATGGGAGG + Intronic
1106586221 13:31058515-31058537 AGGTGTGGGTTGAGAGTGGAGGG + Intergenic
1106590319 13:31092969-31092991 AAGTGTCAGGTGAGGCTCCAGGG - Intergenic
1106964224 13:35039438-35039460 AGGAGGGAGGTGAGGCAAGATGG - Intronic
1107035445 13:35897406-35897428 AGGTGTGAGGTAAGACTGGCTGG + Intronic
1107589407 13:41886267-41886289 ATGTGAGAGATGAGGCTGGCAGG - Intronic
1108212492 13:48152328-48152350 GGGTGTGAGGGGATGCAGGAGGG + Intergenic
1108537985 13:51406078-51406100 AGGTTAGGGGTGAGGATGGAAGG - Intronic
1108571349 13:51754953-51754975 AAATGAGAGATGAGGCTGGAGGG - Intronic
1108672117 13:52701917-52701939 AGGTGTGAAGTGAAGCTGCATGG - Intergenic
1109930389 13:69208593-69208615 AGGTGTGAAGGGAGCCTGGAAGG + Intergenic
1110319017 13:74138881-74138903 AGGTGTGTGCCCAGGCTGGAGGG - Intergenic
1110572280 13:77018907-77018929 AAGTTGGAGGTGAGGGTGGAGGG - Intronic
1110763170 13:79252747-79252769 TGGTGTGAGAAGAGGCTGAAGGG - Intergenic
1111683038 13:91467365-91467387 AAGTGTGGGGTGAGGATGGTTGG + Intronic
1111896662 13:94150465-94150487 AGGTGAGAAATGAAGCTGGAAGG - Intronic
1112440110 13:99418853-99418875 AGGGGGGCTGTGAGGCTGGATGG + Intergenic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441375 13:99426991-99427013 AGGAGAGAGGGGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112548104 13:100391364-100391386 AGAGGTGAGGTGAGACTGGGAGG + Intronic
1112781323 13:102904150-102904172 TGGTGTGTGGTGAGGCGGAAGGG + Intergenic
1113446228 13:110369767-110369789 AGCTTTGGGGTGAGGCTGGCTGG - Intronic
1113453537 13:110430868-110430890 AGGTATGGGGTGGGGATGGAAGG - Intronic
1113539009 13:111092394-111092416 AGGGGGCAGGTGGGGCTGGAGGG - Intergenic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114347980 14:21817208-21817230 AGGAGTGAGGTGTTGCTGAAAGG - Intergenic
1114855995 14:26444502-26444524 AGATGTGATGGGAAGCTGGAAGG + Intronic
1115054660 14:29108688-29108710 AGGTGGGTGTTGAGGCTGGGAGG + Intergenic
1115514132 14:34168266-34168288 GGTAGAGAGGTGAGGCTGGAAGG - Intronic
1115673475 14:35643182-35643204 AGGGGTGGGGGGAGGCGGGAGGG + Intronic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1116230105 14:42205045-42205067 TGGGGTGGGGTGAGGGTGGAGGG - Intergenic
1117717770 14:58598379-58598401 AGGTGGGAGGCGAGGGTGGGAGG + Intergenic
1117756150 14:58976124-58976146 AGGAGTGAGGAGAAGCTGGAGGG + Intergenic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1119027411 14:71165179-71165201 AGGTGTAGGATGAGGCTGTATGG - Intergenic
1119384092 14:74246316-74246338 AGGTGTGATGTGTGCCTGGGAGG + Intronic
1119545547 14:75469043-75469065 AGGTGGGACGTGAGTCTGGCTGG + Intronic
1119585355 14:75829173-75829195 AGGTGTGAGTTGAACCTGGAAGG + Intronic
1121099315 14:91239213-91239235 AGGTGCTAGGAGAGTCTGGAAGG + Intronic
1121114672 14:91335348-91335370 CGGTGAGAGGTGAGGCTGGAGGG - Intronic
1121173616 14:91874211-91874233 GTGTGGGAGGTGGGGCTGGATGG - Intronic
1121426946 14:93859134-93859156 GGGTGAGAGGTGCGGCTGGAGGG + Intergenic
1121432938 14:93900212-93900234 TGGACGGAGGTGAGGCTGGAGGG + Intergenic
1122019762 14:98827986-98828008 AGATGTGAGGTGGGCCTGGTGGG + Intergenic
1122408916 14:101516294-101516316 TGGTGGGAGGTGAGGGTGGAAGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122634715 14:103124544-103124566 AAGGCTGAGGTGAGGCTGGCAGG + Intronic
1123466651 15:20521441-20521463 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123651463 15:22479600-22479622 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123741881 15:23288461-23288483 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123745115 15:23314097-23314119 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124059537 15:26276823-26276845 AGGTGTGAGTAGACGCAGGAAGG + Intergenic
1124267858 15:28253506-28253528 AGGTGAGAGGAGAAGTTGGAGGG - Intronic
1124277386 15:28337417-28337439 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124305316 15:28574189-28574211 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1125253024 15:37728045-37728067 TGGTGGGAGATGAGGTTGGAAGG - Intergenic
1125388763 15:39169000-39169022 AGATCTAAGGTGAAGCTGGAGGG + Intergenic
1125458105 15:39881074-39881096 AGGTGAAAAGTGAGGCTGGAGGG - Intronic
1125837257 15:42763740-42763762 TGGATTGAGGTGAGGGTGGATGG + Intronic
1126131421 15:45345166-45345188 AGGTAAGAGGTGAGGCTTGCAGG - Intergenic
1127281744 15:57498886-57498908 TGGTGTGAGATGGGGCTGGAAGG + Intronic
1127320486 15:57840539-57840561 AGGTGTGAGTTGATGATAGATGG - Intergenic
1127500457 15:59549619-59549641 AGGTGTGGGGTGGGGATGGGTGG + Intergenic
1128707875 15:69850835-69850857 AGGGGTGAGGAGAGGATGGGAGG - Intergenic
1128757605 15:70194160-70194182 AGGTGTGTGGTGAGTCAGGACGG - Intergenic
1128762010 15:70223503-70223525 AGGCCTGAGGGGAGGCAGGAGGG - Intergenic
1128762863 15:70229744-70229766 GAGTGAGAGTTGAGGCTGGAAGG + Intergenic
1129136444 15:73556575-73556597 AGTTGTGAGGTGAGACATGATGG + Intronic
1129144884 15:73637822-73637844 TGGTGTGGGGTGAGGCTGCTGGG - Intergenic
1129150599 15:73685176-73685198 AGGTGGGGGGTGAGGTGGGATGG + Intronic
1129676473 15:77634642-77634664 AGGTGGGAGGTGAAGCAGGGAGG + Intronic
1129848506 15:78778936-78778958 AGGTGTGGAGAGAGGCTGGGAGG + Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1130022813 15:80245258-80245280 AGGTGCCTGGTGAGGCTGGTTGG - Intergenic
1130100030 15:80886296-80886318 GGGTGAGAGGTGAGGCTGGAGGG + Intronic
1130300054 15:82673897-82673919 AGGTGAGATGTGTGGCAGGAGGG - Intronic
1131150436 15:90044224-90044246 AGGCGTGAGGTGGGACTGGCAGG + Intronic
1131234925 15:90687822-90687844 AGGTGGGAGGTGACCCTGGGAGG - Intergenic
1131313086 15:91308276-91308298 AGGAAGGAGGTGAGGATGGAGGG + Intergenic
1131441322 15:92461674-92461696 TGGTGGGAGCTGAAGCTGGAGGG + Intronic
1131641776 15:94300928-94300950 TGGTGTGATGTGTGTCTGGAAGG + Intronic
1132567953 16:631753-631775 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568047 16:632122-632144 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568055 16:632148-632170 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132713216 16:1278412-1278434 AGGTGTGCGGTGGGGGTGGGGGG - Intergenic
1132772932 16:1574685-1574707 AGGTGGGAAGGGAGGCAGGAGGG - Intronic
1132976786 16:2715180-2715202 AGGTGTGAGGTGAGGGGGCCTGG + Intronic
1133035640 16:3032608-3032630 AGGAGTGGGGTGGGGGTGGAGGG + Intronic
1133530559 16:6651410-6651432 AGGTGTGACATGATGGTGGATGG - Intronic
1134093494 16:11403956-11403978 AGGGATGAGGCGAGGCAGGAGGG - Intronic
1134218214 16:12332875-12332897 AGCTTGGAGGTGAGGCTTGAAGG - Intronic
1135118056 16:19740374-19740396 AGGTGCAAGGTGTGGCTGAATGG + Intronic
1135842161 16:25886796-25886818 AGGTGGGAGGTGAGGCAGGTGGG + Intronic
1136307428 16:29381811-29381833 AGGTTGGAGCTGAGGGTGGAAGG + Exonic
1137446872 16:48537290-48537312 AGGAGTGAGGTGAGGATTAAAGG + Intergenic
1137688340 16:50402394-50402416 AGGTGAGAGATGAGGCTGGCAGG - Intergenic
1137721590 16:50630609-50630631 TGGAAGGAGGTGAGGCTGGAGGG + Intronic
1138383598 16:56620555-56620577 AGGTGGGGGGTGAGGCGGGGGGG + Intergenic
1138454892 16:57115580-57115602 GGGTGTGGGGTGGGGATGGAGGG - Intronic
1138459987 16:57142458-57142480 TGGGGTGAGGTGAGGCTGAAAGG + Intronic
1138482578 16:57313321-57313343 GGGTATGAGGGGAGGCTGGTGGG + Intergenic
1138534630 16:57653353-57653375 GGCTGTGAGGGGAGGCAGGAAGG + Intronic
1138544357 16:57706856-57706878 AGGAGAGAGGGGAGGATGGATGG - Intronic
1138559038 16:57789075-57789097 ACGTGTGTGGTGGGACTGGACGG - Intronic
1138740946 16:59309576-59309598 AGGGGAGTGGTGAGGCTAGAGGG - Intergenic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1139375820 16:66495627-66495649 AGGTGGGAGGTGGGGATGGATGG - Intronic
1139451256 16:67029477-67029499 GAGTGTGAGGTGAGGCAGGCGGG + Exonic
1140506257 16:75475156-75475178 TGTTGTGAGGTGAGGCTTGATGG - Exonic
1141167236 16:81668883-81668905 AGGTGTGAGGTGGGTACGGAAGG - Intronic
1141167247 16:81668930-81668952 AGGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167281 16:81669078-81669100 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167302 16:81669170-81669192 AGGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167311 16:81669216-81669238 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167321 16:81669264-81669286 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167374 16:81669492-81669514 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167388 16:81669563-81669585 AGGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167394 16:81669586-81669608 AGGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167405 16:81669632-81669654 AGGTGTGAGGTGGGTGTGGAAGG - Intronic
1141172614 16:81700797-81700819 AGGTCTGGGATGTGGCTGGATGG + Intronic
1141308726 16:82892079-82892101 AGGGATGAGCTGAGGTTGGAAGG - Intronic
1141380858 16:83575496-83575518 TGGTGTGAGCAGGGGCTGGATGG - Intronic
1141503578 16:84460873-84460895 AGATGTGAGCTGTGGCAGGAGGG - Intronic
1141651238 16:85394180-85394202 AGGGGAGAGGCGGGGCTGGAGGG + Intergenic
1141674984 16:85513145-85513167 AGGAGTCAGGTGTGGCTGGGGGG - Intergenic
1141685125 16:85565790-85565812 AGGTGTGAGAAGAAGCAGGAGGG + Intergenic
1141815850 16:86408829-86408851 AGTAGGGAGGTGAGGCTGGAGGG - Intergenic
1141826687 16:86485618-86485640 AGGAGCGAGGTGAGGCTGGGTGG - Intergenic
1142012477 16:87722893-87722915 AAATGTGAGGTGAGGGTGGGTGG + Intronic
1142488284 17:260794-260816 AGGTGAGAGGTGAGGCTGAGAGG - Intronic
1142494544 17:299381-299403 AGGTAAGAGGAGAGTCTGGAAGG + Intronic
1142880671 17:2880322-2880344 GGGTGGGAGATGAGGCTGGGTGG + Intronic
1143497651 17:7321606-7321628 AGCTGTGAAGTGAGGCGTGATGG - Exonic
1143607558 17:7998138-7998160 AGGAGTGAGGTGGGGCTTGGTGG + Intergenic
1143845668 17:9771377-9771399 AGGTGAGGGGTGTGGCTGCAGGG + Intergenic
1144011401 17:11151548-11151570 AGGTGAGAGGTGAAGCCGGCTGG - Intergenic
1144643188 17:16950721-16950743 GGGTGTGAGGTCAGGCAGGGAGG - Intronic
1144643195 17:16950743-16950765 GGGTGTGAGGTCAGGCAGGGAGG - Intronic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144756981 17:17685821-17685843 AGGTGCCAGCTGTGGCTGGAGGG - Intronic
1144835676 17:18155442-18155464 AGGGGTGAAGTGGGGCTGGCTGG + Intronic
1144844009 17:18206498-18206520 TGGAGTGAGGTGAGGCTGCTTGG + Intronic
1145016280 17:19400444-19400466 AGGGGTGGGGTGAGGGTGGGAGG - Intergenic
1145205546 17:20983277-20983299 GGGTGTGAGGTCAGGCAGGGAGG + Intergenic
1145215034 17:21044453-21044475 AGGTGTGTGATAAAGCTGGAAGG - Intergenic
1145224600 17:21117348-21117370 AGCTGTGCAGTGATGCTGGAGGG - Intergenic
1145259109 17:21344129-21344151 AGGCGGCAGGTGAGGCTGCAAGG - Intergenic
1145317509 17:21743874-21743896 AGGCGGCAGGTGAGGCTGCAAGG + Intergenic
1146281616 17:31548938-31548960 AGGAGAGAGGTGAGTCTGCATGG - Intergenic
1146329741 17:31917393-31917415 GGCTGTGAGGTTGGGCTGGAGGG - Intergenic
1146451648 17:32979304-32979326 GGTTGGGAGGTGAGGCTGCAGGG + Intronic
1146588703 17:34107936-34107958 AAGTGTGAGGCGAGGTGGGATGG - Intronic
1146750364 17:35373402-35373424 GGGTGTGGGGAGGGGCTGGAGGG - Intronic
1146953199 17:36920818-36920840 TGTTGGGAGGTGAGGGTGGAGGG + Intergenic
1147026763 17:37592751-37592773 AGGAGTAAGGTGGGGCAGGAAGG + Intronic
1147193257 17:38749000-38749022 AGGTGCGGGGTGAGGCCGGGTGG + Intronic
1147418414 17:40309773-40309795 AAGTGTGAGATGAACCTGGAAGG - Intronic
1147689330 17:42305817-42305839 AGAGGTGAGGTGAGGCCAGAAGG + Intronic
1148048277 17:44757354-44757376 GGGTGTGTGGTGAGGGTGCATGG + Intergenic
1148150013 17:45391398-45391420 AGGTGTGAGCTGAGGCTTGGGGG + Intergenic
1148384916 17:47227518-47227540 AGGTGAAAGGAGAGGCAGGAGGG - Intergenic
1148935951 17:51164967-51164989 ATGTGTGTAGTGAAGCTGGAGGG + Intronic
1149490495 17:57081633-57081655 AGAAGAGAGGTGAGGGTGGAAGG - Intergenic
1149567356 17:57649713-57649735 GGGTGACTGGTGAGGCTGGATGG + Intronic
1149596442 17:57867343-57867365 ACGCGTGTGGTGAGGCTGGAGGG - Exonic
1149990058 17:61378140-61378162 GGGTGGGAGGTCAGGCTGGAAGG - Intronic
1150219479 17:63487936-63487958 AAGTGTGAGGGGAGGCTGGCCGG + Intronic
1150342957 17:64383620-64383642 AGGGTTGTGCTGAGGCTGGAAGG - Intronic
1151422794 17:74009625-74009647 AGGCGGGAGGTGAGGGTGGAGGG - Intergenic
1151715253 17:75827854-75827876 AAGTGTTAGGCCAGGCTGGAGGG + Exonic
1152122997 17:78430062-78430084 AGGTGTGACGTGAGACTGCAAGG - Intronic
1152239022 17:79152037-79152059 AGGGGTGATGGGAGGCTGGGAGG + Intronic
1152289906 17:79434155-79434177 GTGTGAGAGCTGAGGCTGGAAGG + Intronic
1152528415 17:80902778-80902800 AGCTGGGAGCTGGGGCTGGACGG - Intronic
1152533672 17:80937861-80937883 AGGTGCGGCGTGAGGCAGGAGGG - Intronic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152944266 17:83190642-83190664 CGGTGTCAGGGGAGGCTGGTGGG - Intergenic
1153977156 18:10279672-10279694 TGGGCTGAGGAGAGGCTGGAAGG + Intergenic
1154009698 18:10564406-10564428 AGGGATGAGGTGAGCCAGGATGG - Intergenic
1155608325 18:27633572-27633594 AGGGGAAAGGTGAGGCTGGAAGG - Intergenic
1156803642 18:41149294-41149316 AGGAGTGAGGTGGGGCTCCATGG + Intergenic
1157166680 18:45363874-45363896 AGATGAGAGGTGAGGCTCGGAGG + Intronic
1157823160 18:50788536-50788558 AGGTGTGGGGTGAGCAAGGAGGG - Intergenic
1157845873 18:51003543-51003565 TGGGGTGAGGGGAGGCGGGAGGG + Intronic
1158566833 18:58561270-58561292 GGGTGTGAGGAAGGGCTGGATGG + Intronic
1158571188 18:58598188-58598210 AGGTGTGGGGTGTGGCCTGAAGG + Intronic
1158623383 18:59051356-59051378 ACGTTTGAGGTGTGGCTGGGTGG + Intergenic
1158939477 18:62393691-62393713 TAGCGTGAGATGAGGCTGGAGGG - Intergenic
1160012241 18:75115025-75115047 GAGTCTGGGGTGAGGCTGGAAGG - Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160536727 18:79598422-79598444 AGGTGGGGGGTGTGGCTGGGAGG - Intergenic
1160570967 18:79817701-79817723 AGGTGGGAGGTGTGGAGGGAGGG - Intergenic
1160872221 19:1282597-1282619 AGGTGTGAAGGGAGGAGGGAGGG + Intergenic
1160873873 19:1288424-1288446 AGGTGTGAGGCTGGGCTGGCCGG + Intronic
1160953537 19:1679144-1679166 AGAAGTGAGGTGAGGCCTGAGGG - Intergenic
1161022361 19:2016059-2016081 AGGTGGGAGGGGAGGAGGGAGGG + Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161127869 19:2570008-2570030 ATGTTGGAGGTGAGGCTGGGTGG + Intronic
1161238631 19:3209930-3209952 AGCTGGGAGGAGAGGCAGGAAGG - Intergenic
1161638844 19:5406945-5406967 ATGTGTGAGCTGAGGCTTGAAGG - Intergenic
1161709931 19:5842018-5842040 AGGTGTGTGGTGTGGGTGGCAGG + Intergenic
1161713696 19:5863907-5863929 AGGTGTGTGGTGTGGGTGGCAGG + Intergenic
1161729351 19:5949652-5949674 AGGTGGAAGGTGAAGCTGTATGG - Intronic
1162156963 19:8684711-8684733 AGGTGAGAGCTGAGTCTGGCAGG + Intergenic
1162740993 19:12773624-12773646 AGGTGAGAGGTAAAGATGGATGG - Intronic
1162796607 19:13090503-13090525 AGGTCTGAGGTGGGGCTGGAGGG + Intronic
1162905328 19:13819573-13819595 GGCTGTGAGTTCAGGCTGGATGG - Intronic
1163007722 19:14406959-14406981 AGGTGAGAGGAGAGGCTGGAAGG + Exonic
1163358383 19:16829664-16829686 AGGTGAGAGGTGAGGGGTGAGGG - Intronic
1164394302 19:27850381-27850403 GGGTGTGGGGTGAGGAGGGAGGG + Intergenic
1164936772 19:32220876-32220898 AGGTGTGTGGCCAGGCTGGGAGG - Intergenic
1165737084 19:38183632-38183654 AGTGGAGAGGTCAGGCTGGAGGG + Intronic
1165744538 19:38222821-38222843 AGGGGAGAGGTGAGGCTGGAGGG - Intronic
1165775689 19:38403225-38403247 GGGTGTGCGGTGAGGCTGGTGGG + Intronic
1165856755 19:38883613-38883635 GGATGAAAGGTGAGGCTGGAGGG - Exonic
1166147211 19:40845942-40845964 AGGTGGAGGGTAAGGCTGGAGGG - Exonic
1166151368 19:40877838-40877860 AGGTGGAGGGTAAGGCTGGAGGG - Exonic
1166155857 19:40910532-40910554 AGGTGGAGGGTAAGGCTGGAGGG - Intergenic
1166318824 19:42003803-42003825 GGGGGTGAGGAGAGGCTGCAGGG - Intronic
1166321930 19:42023976-42023998 AGATATGAGGGGAGGCTGGCAGG - Intronic
1166870027 19:45865326-45865348 TTGTCTGAGGTGAGACTGGATGG - Intronic
1166933641 19:46317594-46317616 ATGTCTGAGCTGAGACTGGAAGG - Intronic
1166960017 19:46491656-46491678 AGGGGTGAGATGATGCTGGGGGG + Exonic
1167131923 19:47592481-47592503 AGTTGTCAGATGAGGGTGGAAGG - Intergenic
1167410906 19:49343217-49343239 AAGGTGGAGGTGAGGCTGGAGGG - Exonic
1168283960 19:55321316-55321338 AGGTGCAAGGAGAGGCTGGGAGG - Intronic
925073182 2:987487-987509 AGAGGAGAGGTGAGGATGGAAGG + Intronic
925476355 2:4221069-4221091 AGGTGCAAGGAGAGGCAGGAGGG - Intergenic
925533247 2:4887431-4887453 GGATGTGGGGTGTGGCTGGAGGG + Intergenic
925976731 2:9146893-9146915 AGGTGTACGGTGAGGCTGCAGGG - Intergenic
926455085 2:13057112-13057134 CCGTGTGAGGTGAGGCTAGCTGG + Intergenic
926611571 2:14953141-14953163 AGCTGTGAGATGGAGCTGGAGGG + Intergenic
926734000 2:16058581-16058603 TGGGGTGAGGTGAGGGTGGGAGG + Intergenic
927013385 2:18930023-18930045 AGGTGAGAGGTGAGGCTGATTGG + Intergenic
927149899 2:20189563-20189585 CAGTGAGAAGTGAGGCTGGAGGG - Intergenic
927414610 2:22865822-22865844 AGGTGTGTGGTGGGGGTGCAGGG + Intergenic
927816955 2:26226638-26226660 TGGTGTGAGGTAAGGATTGAGGG - Intronic
927863302 2:26573764-26573786 ATGTGAGTAGTGAGGCTGGAGGG + Intronic
927871903 2:26629191-26629213 AGGACCGAGGTGAGGATGGAGGG + Intronic
928107142 2:28477896-28477918 AGGGGTGAGGTGAGGGCTGATGG - Intronic
928363898 2:30687167-30687189 AGGTGAAAGTGGAGGCTGGACGG + Intergenic
928432435 2:31232097-31232119 AGGAGTGTGGTGAAGCTGCAGGG - Intronic
929016547 2:37503178-37503200 AGGTTTGAGGTGAGACATGAAGG + Intergenic
929226474 2:39516262-39516284 AGGTGGGAGGTGCGACTGCATGG + Intergenic
929551673 2:42897177-42897199 TGGTGTGATGTGAGGATGGTAGG + Intergenic
930896990 2:56458122-56458144 TGGAGAGAGGTGAGGATGGAAGG - Intergenic
931483749 2:62669737-62669759 AGATGGGAGATGAGGCTGGCTGG + Intergenic
931937309 2:67213740-67213762 TGGTGTCAGGGGAGCCTGGATGG - Intergenic
931978101 2:67665691-67665713 AGGAGTGAGGTAAAGTTGGAAGG - Intergenic
932018528 2:68058723-68058745 AGATGGGAGTTAAGGCTGGAAGG - Intronic
932409093 2:71534745-71534767 AGGTGTGAGTTAAGGGTAGAAGG + Intronic
932467243 2:71931745-71931767 AGGTCAGAGGTGAGGCTGGGTGG - Intergenic
932850679 2:75181860-75181882 AGGAGTGAGGTCAGGTTGGGAGG - Intronic
933463659 2:82622171-82622193 GGGTGAGAGGTGAAGCTGGCTGG + Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933998001 2:87684100-87684122 AGGTGTGAGGTGAGGCGTGTTGG - Intergenic
934886565 2:98030529-98030551 AGGTGAGAGCAGAGGATGGAGGG - Intergenic
935147586 2:100406395-100406417 AGGTGTGAGGGGAGGTAGGGTGG - Intronic
935151670 2:100442493-100442515 AGCTGGGAAATGAGGCTGGAAGG - Intergenic
935388242 2:102523712-102523734 GTGTGAGAGGTGAGACTGGAGGG - Intronic
935636932 2:105256265-105256287 TGGTGAGAGATAAGGCTGGAGGG - Intergenic
935693366 2:105749719-105749741 CGGTGTGAGGGGAGGCCGGCAGG + Intronic
936031780 2:109078499-109078521 AGGGGTGAGGTGAGGTGGGATGG + Intergenic
936252014 2:110874372-110874394 GGATGTCAGGTGTGGCTGGAAGG - Intronic
936295849 2:111266766-111266788 AGGTGTGAGGTGAGGCGTGTTGG + Intergenic
936340402 2:111626244-111626266 TGGTGTCAGTTGAGGCTGCATGG + Intergenic
937089607 2:119197061-119197083 GGGGGTGAGGGGAGGATGGAGGG + Intergenic
937227577 2:120378571-120378593 AAGTGGGAGGCGAGGCTGGCAGG + Intergenic
937972973 2:127564557-127564579 AGGTGTGTGGAGGGGCAGGACGG + Intronic
938391427 2:130909512-130909534 AGGAGTGAGGAGAGGCAGAAGGG + Intronic
938613287 2:132971372-132971394 GGGAGGGAGATGAGGCTGGATGG + Intronic
938687189 2:133750238-133750260 AGTTGTTAAGTGAGGCTGGAGGG + Intergenic
938688050 2:133760488-133760510 ACCTCTGAGGTTAGGCTGGACGG + Intergenic
938981644 2:136532673-136532695 AGGTGGGAGCTGAGGTGGGAGGG + Intergenic
939334369 2:140806506-140806528 AGGTGTGAGTGAAGGGTGGAGGG + Intronic
939730384 2:145777305-145777327 AGGTTTGGGGTGAAGCTGAATGG + Intergenic
940044444 2:149393937-149393959 AGGTGCCAGATGAGACTGGAAGG + Intronic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
942136587 2:172931944-172931966 GGGTGTGAGGAGTGGCGGGAAGG - Intronic
942241003 2:173964317-173964339 AGGGGTGAGGCGAGGAGGGAGGG + Intronic
943868395 2:192959021-192959043 AAGTGAGAGGTGAAGCTGGCTGG - Intergenic
944712606 2:202348534-202348556 AGGTCTGAGTTAAGGCTGAAAGG - Intergenic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
946037396 2:216754967-216754989 AGGTGTGAGAGGAGCCTGCATGG - Intergenic
946743693 2:222825670-222825692 AGGTGTGATGTGAAGATGGGAGG - Intergenic
947943226 2:234076669-234076691 TGGTGTGAGGTAAGGAAGGAAGG - Intronic
948165698 2:235860455-235860477 ATCTGTGATGTGAGACTGGAAGG - Intronic
948223827 2:236293501-236293523 AGGTGTGAGCAGAGGCTGGGAGG - Intergenic
948261394 2:236606889-236606911 GGATCTGGGGTGAGGCTGGAAGG - Intergenic
948481238 2:238251842-238251864 ATGAGTGGGGTGAGGGTGGAGGG + Intronic
948882727 2:240868756-240868778 AGGTGAGAGGTGAGGATTGGTGG - Exonic
949059252 2:241947332-241947354 AGGTGGGGGGTGGGGCTGCAGGG - Intergenic
1169060399 20:2656572-2656594 AGGTGTGAGAAGGGGCTGGGTGG + Intronic
1169251850 20:4067133-4067155 TGGTGTGGGATGAGGCTGGTAGG + Intergenic
1169445170 20:5665668-5665690 AGGGGTGGAGTGAGGATGGAGGG - Intergenic
1170315025 20:15032134-15032156 GGGAGTGAGGAGAGGCCGGAGGG + Intronic
1170510949 20:17076177-17076199 AGGTGTGAGGTGAGAGTGGTAGG + Intergenic
1170608312 20:17890548-17890570 AGGTGTTGGCTGGGGCTGGAGGG - Intergenic
1171026659 20:21636924-21636946 AGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171046604 20:21813988-21814010 GGGAATGAGATGAGGCTGGAGGG - Intergenic
1172578298 20:36026570-36026592 AGGTGGCAGGAGATGCTGGAGGG - Intronic
1172846982 20:37935443-37935465 AGGCAAGAGGTGAGGCTGGAGGG - Intronic
1172848554 20:37944622-37944644 AGGAGGGAGGCGAGGCTGGGGGG - Exonic
1174067371 20:47875186-47875208 TGGTGGGAGGTGGGACTGGACGG + Intergenic
1174128816 20:48327611-48327633 AAGGGTGATGTGTGGCTGGAGGG - Intergenic
1174156930 20:48521688-48521710 TGGTGGGAGGTGGGACTGGACGG - Intergenic
1175667910 20:60876247-60876269 GGCTGTGAGCTGAGCCTGGAGGG - Intergenic
1176136555 20:63524988-63525010 AGGAGTGAGCGGAGGATGGAAGG + Intergenic
1176160013 20:63642994-63643016 TGGTGGGAGGGGAGGCTGCAGGG + Intronic
1176219574 20:63963574-63963596 AGGTCAGAGGTCACGCTGGACGG + Intronic
1177123666 21:17168869-17168891 TGGGGTGGGGGGAGGCTGGAGGG + Intergenic
1177753507 21:25316420-25316442 AGGGGTGAGGTGAGGAAGGGGGG + Intergenic
1178108367 21:29347030-29347052 AGGTCTGAGGTTAGACTGTAAGG + Intronic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179603968 21:42499961-42499983 AGCTGGGAGGTGGGCCTGGAAGG - Intronic
1179998628 21:44985204-44985226 AGGGTGGAGGTGAGGCTGGGCGG + Intergenic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180945698 22:19691929-19691951 ATGTGTGAGGTTAGGAGGGAAGG + Intergenic
1181095719 22:20503968-20503990 AGATTGGAGGTGAGGCTGTATGG + Intronic
1181107217 22:20582497-20582519 AGGTGTGTGGTGAGGCTGTGCGG + Intronic
1181543046 22:23584150-23584172 AGGGGTGAGGTGAGCCTGGGTGG - Intergenic
1181771287 22:25127561-25127583 AGGGGTGGGGTGGGGCAGGATGG - Intronic
1181895545 22:26104526-26104548 TGGTGATAGGTGAGGCAGGAAGG - Intergenic
1182277478 22:29199955-29199977 ATGTCTGAGCTGAGACTGGATGG + Intergenic
1183083344 22:35471397-35471419 GGGTTTGAGCTGAGGCTGGATGG - Intergenic
1183525700 22:38321255-38321277 AGGTGAGAGGTGAGGGGGGTTGG - Intronic
1183539086 22:38419293-38419315 CGGGGGGAGGTGAGGCAGGAGGG + Intergenic
1183722667 22:39571578-39571600 TGGTGGGAAGTGAGGCTGGGTGG - Intronic
1183725052 22:39583965-39583987 TGGCCTGAGATGAGGCTGGAGGG + Intronic
1183759955 22:39806991-39807013 AGGTTAAAGGTGAGGCTGCAGGG + Intronic
1184094607 22:42309690-42309712 AAGTCTGAGCTGAGACTGGAAGG - Intronic
1184190638 22:42892186-42892208 TGGGGTGGCGTGAGGCTGGAGGG + Intronic
1184257366 22:43294842-43294864 AGGTGAGCGTTGAGGCTGGGCGG + Intronic
1184373698 22:44098488-44098510 AGGAGTGAGGGAAGGCCGGATGG + Intronic
1184473762 22:44710069-44710091 AGGTGGGATGTGAGGCGGGTAGG + Intronic
1184583766 22:45434188-45434210 TGGTGTGGGGTGGGGGTGGAAGG + Intergenic
1184657187 22:45947748-45947770 GGGTGTGAGGTGAGGATGGTGGG + Intronic
1184717553 22:46290553-46290575 AGGAGGGTGGTGTGGCTGGAGGG + Intronic
1184726849 22:46352013-46352035 AAGTGTGGGGTGAGGCCGGGAGG + Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
949165426 3:935026-935048 AGGTTGGAGGTGAGGCTTGATGG - Intergenic
949206550 3:1446317-1446339 AGTAGTAATGTGAGGCTGGAGGG - Intergenic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
950008399 3:9705423-9705445 CGGTGTGGGGTGGGGCTGGGTGG - Intronic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950465273 3:13149624-13149646 TGATGGGAGGTGAGACTGGAAGG + Intergenic
950644841 3:14371027-14371049 GGGTGTGGGGTGATGCTGGTGGG - Intergenic
950774628 3:15338805-15338827 AGATGTGAGGAGTGGCTGGCTGG + Intronic
950842816 3:15983706-15983728 AGGGTTGAGGTGAGGGTGGTGGG + Intergenic
950857001 3:16115151-16115173 TGGCGTGAGCTGAGGCAGGAGGG + Intergenic
951035802 3:17930621-17930643 GGGTGGGAGGTGAGGGTAGAGGG + Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952211420 3:31232373-31232395 AGGGGTGGGGTGAGGGCGGAGGG - Intergenic
952524103 3:34191874-34191896 AGGTGTCAGTTGTGTCTGGAAGG + Intergenic
952810246 3:37396240-37396262 AGGAGTGAGTGGAGGTTGGATGG - Intronic
952904895 3:38133278-38133300 AGCTAGGAGATGAGGCTGGAAGG + Intronic
952909022 3:38166152-38166174 TGGGGTGGGGTGAGGCTTGAGGG + Intronic
953335285 3:42089286-42089308 AGGTGTGAGATGGGGGTGGCTGG - Intronic
953378277 3:42447076-42447098 GAGTGTGAGGTGGGGCTGGGAGG - Intergenic
953571939 3:44078187-44078209 GGGGGTGAGCTGGGGCTGGAGGG - Intergenic
953786827 3:45917313-45917335 GGGTGTGAGGTGAGTGTGGGTGG + Intergenic
953818831 3:46186416-46186438 TGGTGTGAGGTGAGGGTCCAAGG + Intronic
953970236 3:47341718-47341740 TGGTGTGGGGTGAAGCTGAAGGG + Intronic
954396560 3:50296354-50296376 AGGTGAGAGGTGAGGGTAGGGGG + Intronic
954795598 3:53160076-53160098 AGGGCAGAGGAGAGGCTGGATGG - Intronic
954849735 3:53590138-53590160 TGGCATGAGCTGAGGCTGGATGG - Intronic
955090888 3:55749421-55749443 AGGTGAGAGGTGAGGCCAGCTGG + Intronic
958896849 3:99839030-99839052 AGGTGTGGGGGCAGGCAGGAGGG - Intronic
959459247 3:106604413-106604435 ATGGGTCAGGTGAGGCTGGGTGG + Intergenic
959796347 3:110433171-110433193 TGGTGTGAGGTGAGGTCAGAGGG + Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959937282 3:112042099-112042121 AGGTGGGGGATGAAGCTGGAGGG + Intronic
960378526 3:116932378-116932400 GGGTGGGAGGTGGGGCTGGTGGG - Intronic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961865077 3:129948064-129948086 AAATCTGAGCTGAGGCTGGACGG + Intergenic
961885821 3:130095718-130095740 AGGTGGGAGGTGAACCTGGGAGG + Intronic
962081660 3:132145719-132145741 ATGTGAGAGATGAGACTGGAAGG + Intronic
962854301 3:139330165-139330187 AGGTGTGAGGTGAGGCTGTGGGG - Intronic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962912789 3:139870124-139870146 AAGTGATAGGTGAGGCTGGTGGG + Intergenic
963025878 3:140918094-140918116 AGGTGTAAGGCAAGGGTGGAGGG + Intergenic
963339089 3:144012566-144012588 AGGGGTGAGGAGAGGCAGGTAGG + Intronic
964555056 3:157927793-157927815 AGGTGAGAAGTGAAGCTGGCTGG - Intergenic
964607285 3:158572129-158572151 AGGTGTGAGGTGTAGGAGGAGGG + Intronic
964751677 3:160059407-160059429 AGGTGTGAAGTGCAGCAGGAAGG + Intergenic
965506494 3:169521089-169521111 AGAAGATAGGTGAGGCTGGAGGG + Intronic
965547855 3:169933936-169933958 AGAGGAGAGGTGAGGCAGGAGGG + Intronic
965973728 3:174595196-174595218 GGATGTGAGGTGTGGCTGGAAGG - Intronic
967954616 3:194868850-194868872 TGGCTTCAGGTGAGGCTGGAGGG + Intergenic
968473625 4:792744-792766 AGGTGGGAGGAGCGGCTGGAGGG - Intronic
968503063 4:960110-960132 GGCGGGGAGGTGAGGCTGGAGGG + Exonic
968610950 4:1556762-1556784 AGGCGTGACCTGAGGCTGGGTGG - Intergenic
968894229 4:3389417-3389439 AAGTGTGAGGTCGAGCTGGAGGG + Intronic
969334448 4:6499349-6499371 TGGGGTGGGGTGAGGCTGAAGGG - Intronic
969483180 4:7457702-7457724 AGGTGTGAGCTGTGGCCAGAGGG + Intronic
969519310 4:7666521-7666543 GGTGGTGAGGTGGGGCTGGAAGG - Intronic
969604722 4:8196728-8196750 AGGTGGGAGATGGGGCTGGCAGG + Intronic
969676113 4:8615197-8615219 AGGTGGGAGGTGAGTGGGGATGG + Intronic
970541197 4:17081596-17081618 ATGTGTGAGCTGAGCCTTGAAGG - Intergenic
971177253 4:24292948-24292970 GGGTGTGAGGTGAGGGGGTAGGG - Intergenic
971319490 4:25593915-25593937 AGTTGTGGGGTGCAGCTGGAGGG + Intergenic
971949626 4:33327945-33327967 AGGTGTTTGGTGAGGGTGGTGGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
973163449 4:47047912-47047934 AGGAGTGAGAAGATGCTGGAAGG + Intronic
973333664 4:48934625-48934647 AGGAGTGGGGTGAGGGTGGCAGG - Intergenic
973549535 4:52019193-52019215 AGATGTGAGATGAATCTGGAAGG - Intergenic
974025153 4:56727116-56727138 ATGTGTGAGCTGAGTCTTGAAGG + Intergenic
974526157 4:63052515-63052537 TGGTGAGAGGTGAAGCTGGCTGG + Intergenic
974626056 4:64430041-64430063 ATGTTTGAGGTAAGGCTAGATGG + Intergenic
975669244 4:76763618-76763640 CAGTGGGAGATGAGGCTGGAAGG + Intronic
975696745 4:77021388-77021410 AGTTGTGGGGTGAGGCTGCCAGG + Intronic
977476107 4:97511951-97511973 TGGTGAGAGATGAGGCTGGAGGG + Intronic
977669317 4:99677584-99677606 GGCTGTGAGGTGAGAATGGAAGG - Intergenic
977744312 4:100527514-100527536 TGGGGTGGGGGGAGGCTGGAGGG - Intronic
978995962 4:115153268-115153290 AGTTGTGAGGTGAAGCTGTGAGG + Intergenic
979495618 4:121379810-121379832 AACTGGGAAGTGAGGCTGGAGGG + Intronic
981235082 4:142406124-142406146 AGGTGGGAGGCGAGGGTGGCGGG - Intronic
981536487 4:145805754-145805776 GGAAGGGAGGTGAGGCTGGAGGG - Intronic
981733448 4:147924005-147924027 GGGTGTGAGGTGAGCGTGGGTGG + Intronic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
983077806 4:163346080-163346102 TGGTGTGGGGTGGGGCTAGAGGG + Intronic
984640918 4:182163375-182163397 AGATGGGAGGCGGGGCTGGAAGG - Intronic
984756945 4:183333250-183333272 AAGCGTGAGGTGAGGGAGGAGGG + Intergenic
985026671 4:185745494-185745516 AGATGTGATGTGAGGTTGGAAGG - Intronic
985256150 4:188071875-188071897 AGGAGTGAGGTGAAGGTGGGAGG + Intergenic
985840101 5:2299594-2299616 AGGTGTGAGGAGTGACTGCAGGG - Intergenic
986013204 5:3735323-3735345 TGGAGTGAGGTCATGCTGGAGGG - Intergenic
986251486 5:6062193-6062215 GGGTGTGAGGTGGGCATGGAAGG - Intergenic
986676120 5:10187400-10187422 AGGTGAGAGGTGAAGCTAGCTGG + Intergenic
986706121 5:10456006-10456028 AGGTGTGAGGTGACTGTTGAGGG + Intronic
986806159 5:11310872-11310894 GCGTGTGAGGTGAGGGTGCATGG - Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
986806392 5:11312220-11312242 GAGTGTGGGGTGAGGCTGTATGG - Intronic
987545643 5:19307720-19307742 AGGTGAGAGGTGAAGCTGTCTGG - Intergenic
987923252 5:24310318-24310340 AAGTGAGAGGTGAAGCTGGCTGG + Intergenic
988511436 5:31867879-31867901 AGGTGTGGGGTGGGGCGGGGAGG + Intronic
988776888 5:34485149-34485171 GGGTGGGAGGTGAGGTTGCAGGG - Intergenic
989125668 5:38050345-38050367 AGGTTTGATGAGAGGCTGGGGGG + Intergenic
989778294 5:45234663-45234685 AGGGCTTAGTTGAGGCTGGAAGG - Intergenic
990350259 5:54908941-54908963 ATGGGTGGGGTGAGGCTGGAGGG - Intergenic
992021249 5:72626367-72626389 TGGTGAGAGGTGAGGCTGTGTGG - Intergenic
992610796 5:78506733-78506755 AGGGGTGATGCTAGGCTGGAAGG + Intronic
992641527 5:78772421-78772443 CGGTCTGAGGTGGGGCTGGGAGG + Intergenic
992749777 5:79851141-79851163 AGGTGTGGGCTGGGGCTGCAGGG + Intergenic
993027566 5:82663965-82663987 AGGTGAGCGGAGTGGCTGGACGG + Intergenic
993867500 5:93212691-93212713 TGGGGTGGGGTGAGGATGGAGGG + Intergenic
993956091 5:94234794-94234816 ATGTTGGAGGTGAGGCTGGTGGG - Intronic
995616738 5:113972902-113972924 AGGTGTGATGTGGGGCAGGAGGG - Intergenic
995763145 5:115585685-115585707 AGGAGTGCCGTGGGGCTGGAGGG + Intronic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
996739951 5:126789555-126789577 TGGTATGAGATGAAGCTGGAGGG - Intronic
996815075 5:127565521-127565543 CCGTGTGAGGTGGGGCTGGCTGG + Intergenic
997454449 5:134006417-134006439 AGTTGAGAGGTGGCGCTGGAGGG - Intergenic
998153500 5:139770717-139770739 ATGTGTGAGGAGGGGCTGAAAGG - Intergenic
998201906 5:140131503-140131525 AGGTGTGAGATGAGCATGCAGGG - Intergenic
998531632 5:142890439-142890461 TGGGAGGAGGTGAGGCTGGAGGG + Intronic
998733847 5:145112128-145112150 AGGTATGAAAAGAGGCTGGAGGG + Intergenic
998887996 5:146714834-146714856 AGGTGTGAGGTCAGGGGAGAGGG - Intronic
999304685 5:150511925-150511947 AGCTGTGGGGTGTGGCTGGGTGG + Intronic
999721270 5:154400818-154400840 TGGAATGAGGTGAGGGTGGAGGG + Intronic
999722592 5:154409754-154409776 TGGGGGGAGGTGAGTCTGGAGGG + Exonic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1000752460 5:165113876-165113898 AGGTGGAAGGGGAGCCTGGAGGG - Intergenic
1001288180 5:170438612-170438634 GGGAGTGTGGTGAGGCTGGTGGG - Intronic
1001549654 5:172593773-172593795 AGGTGGGAGGTGGGGCTGCCAGG + Intergenic
1001634466 5:173199753-173199775 AGGTGGGAGATGAGGCTGGAGGG + Intergenic
1001746762 5:174098414-174098436 AACGCTGAGGTGAGGCTGGAAGG - Intronic
1001850194 5:174957107-174957129 AGTGGTGAAGTGAGGCTTGATGG - Intergenic
1002010248 5:176273645-176273667 TGGGGTGAGGTGAGGGGGGAGGG - Intronic
1002025704 5:176395064-176395086 GGGTGGGAGCTGAGGCTGGGAGG - Intronic
1002069641 5:176671701-176671723 TGGTGTCAGGTGAGGCTTGCCGG + Intergenic
1002097225 5:176838729-176838751 AGGTGTGGGGTGAGGATGTGAGG - Intronic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002305243 5:178279221-178279243 AGGTGACACGTGAGTCTGGAAGG - Intronic
1002442356 5:179271007-179271029 AGGGGTGAGGCTGGGCTGGAAGG - Intronic
1002598982 5:180343249-180343271 AGGAGTGAAGTGTGGCTGGGAGG - Intronic
1003243861 6:4367971-4367993 GGGTTTGTGATGAGGCTGGAGGG + Intergenic
1003409539 6:5850677-5850699 AGGTGGGAGGTGGGGTTGGGCGG - Intergenic
1003500038 6:6696047-6696069 AGGGGTGAGGTCTGGCTGGAGGG + Intergenic
1003912474 6:10754905-10754927 TGGTAAGAGATGAGGCTGGAAGG + Intronic
1004527164 6:16419761-16419783 GAATGTGTGGTGAGGCTGGAGGG + Intronic
1004569701 6:16833325-16833347 TGGGGTGAGGAGAGGTTGGAGGG - Intergenic
1006322581 6:33328966-33328988 AGGTGAGAGGGGAGACAGGAGGG - Intronic
1006369739 6:33636525-33636547 AGGTGTGAGGTGTGAGTGGAAGG + Intronic
1006739406 6:36296692-36296714 AGGGGGGTGGAGAGGCTGGACGG + Intronic
1006985281 6:38172043-38172065 AGGTGGCAGGTGAGGCTGACAGG - Exonic
1006986414 6:38178594-38178616 ACATCTGAGGTGAGTCTGGAAGG + Intronic
1007110658 6:39311829-39311851 AGGTGGGAGGTGAGACTGCCTGG + Intronic
1007110758 6:39312369-39312391 GGGGGTGAGGTGGGGGTGGAGGG + Intronic
1007221076 6:40279497-40279519 TGGTGGGAGGTGGGGCTGGGTGG - Intergenic
1007816069 6:44526331-44526353 AGGTTTCAGGGGAGGCTGGGTGG + Intergenic
1007960345 6:45953341-45953363 AGGTGCTGGGTGAGTCTGGAGGG + Intronic
1009344764 6:62599974-62599996 AGGTGTGTGGTCAGGAGGGAAGG + Intergenic
1011232655 6:85180134-85180156 AGGGGCGAGGTTAGGGTGGAAGG - Intergenic
1011251917 6:85380743-85380765 TGGGGTGGGGTGAGGGTGGAGGG + Intergenic
1013082443 6:106824218-106824240 AAGTGAGGGGTGGGGCTGGAGGG + Intergenic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1013330701 6:109096938-109096960 AGCTGAGAGGTGAAGCTGAATGG - Intronic
1014689396 6:124544302-124544324 AGTTGGGAGGTGGGGGTGGAGGG - Intronic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1015712825 6:136160741-136160763 TGGTGGGAAGTGAGGCTGGAAGG - Intronic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1016690527 6:146932615-146932637 GGGTGAGAGAGGAGGCTGGAAGG - Intergenic
1016993216 6:149943441-149943463 AGGTGTGAGCTGAGGGTGAGGGG + Intronic
1017005117 6:150024090-150024112 AGGTGTGAGCTGAGGGTGAGTGG - Intronic
1017011728 6:150068144-150068166 AGGTGTGACCTGAGGGTGGGGGG - Intronic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017456273 6:154604106-154604128 AGGGTGGAGGTGAGGCTGGGTGG - Intergenic
1017754551 6:157518388-157518410 AGGGGTGGGGGGAGGGTGGAAGG + Intronic
1017757634 6:157542913-157542935 AGGTGGGATATAAGGCTGGAGGG + Intronic
1017859149 6:158379108-158379130 AGGTGTGATGTGAAACTGGCTGG + Intronic
1018093218 6:160363143-160363165 AGGTCCGAGAAGAGGCTGGAAGG + Intronic
1018176205 6:161181425-161181447 GGGTGTGAACTGAGCCTGGAGGG - Intronic
1019197235 6:170289880-170289902 GGGTGTGCGGAGAGCCTGGAAGG + Intronic
1019265263 7:112238-112260 TGGTGGGAGGTAAGGCTTGAAGG + Intergenic
1019384077 7:744080-744102 TGGGGTGAGGTGAGGGGGGAGGG - Intronic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019848170 7:3527640-3527662 TGGTGGGAGGTGAGGTTGGAGGG + Intronic
1020283556 7:6663819-6663841 AGGTGGGAGGTGAAGGGGGAGGG + Intergenic
1022450922 7:30514012-30514034 AGGAGTGAGATGAGGATGGGAGG - Intronic
1022740027 7:33111907-33111929 AGGTATGAGGAGAGGTCGGATGG + Intergenic
1022840198 7:34157102-34157124 AGGTGTGAGATGTGGCTGGGAGG + Intergenic
1023035436 7:36127409-36127431 TGGGGTGAGGTGAGGCCTGATGG + Intergenic
1023494131 7:40776721-40776743 AGGTGTGAGCTAAAGCTGGCTGG + Intronic
1023781339 7:43658772-43658794 AGGTGACATGTGAGACTGGAGGG + Intronic
1023911865 7:44562051-44562073 AGGTTTGCGGATAGGCTGGAGGG + Intergenic
1023959418 7:44914063-44914085 AGGAGTGTGTGGAGGCTGGAGGG - Intergenic
1024220203 7:47281230-47281252 GGCTGTCAGGTGAGCCTGGAAGG - Intronic
1024267081 7:47614964-47614986 AGGGGTGAGGTTGGGCTGGTGGG - Intergenic
1024971990 7:55079123-55079145 AGGCATGGGCTGAGGCTGGAGGG + Intronic
1025115088 7:56250838-56250860 AGTTGAGAGGTGAGGGTGGAGGG + Intergenic
1025901882 7:65751275-65751297 AGATGTAAGGTGGGGCTGGCGGG + Intergenic
1026677748 7:72442164-72442186 AGGTGAGAGGTGATGGTGGCTGG - Intronic
1027523847 7:79243192-79243214 ATGTGTGAGCTGATGCTGTATGG - Intronic
1027876898 7:83782355-83782377 TGGTGAGAGGTGAAGATGGATGG - Intergenic
1028211164 7:88076513-88076535 AGGTGTGGGGTGGGGCAGGGTGG - Intronic
1029100275 7:98124194-98124216 AGATGTGAGGTGAAGCTGGAGGG - Intronic
1029510769 7:100993551-100993573 TTGTGTGAGTTGAGGCTGGGTGG - Exonic
1029510859 7:100994136-100994158 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029511263 7:100996800-100996822 TCGTGTGAGTTGAGGCTGGGTGG - Exonic
1029511356 7:100997385-100997407 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029511489 7:100998222-100998244 TCGTGTGAGTTGAGGCTGGGTGG - Exonic
1029511579 7:100998807-100998829 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029511987 7:101001471-101001493 TCGTGTGAGTTGAGGCTGGGTGG - Exonic
1029512076 7:101002056-101002078 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1030191088 7:106810776-106810798 AGGGGTGGGGTGGGGTTGGAGGG - Intergenic
1030313943 7:108095048-108095070 AGGGGTGAGGGGAGGCTGATAGG + Intronic
1031539386 7:122975410-122975432 AGTGGTGGGTTGAGGCTGGATGG + Intergenic
1031976890 7:128099753-128099775 ATGTGTTAGGACAGGCTGGAGGG - Intergenic
1032033862 7:128506951-128506973 AGGTGCTATGTGGGGCTGGAAGG + Intergenic
1032877841 7:136056822-136056844 GGGTGGGAGGTGAGGCAGGTTGG + Intergenic
1033555642 7:142486638-142486660 AGCTGAGAGGTGAGGATGGGGGG + Intergenic
1033599047 7:142876115-142876137 AGGAGAGACGAGAGGCTGGAGGG + Intronic
1033657757 7:143384492-143384514 AGGTGTGGGGTGGGTCAGGAGGG + Intronic
1034547524 7:151798893-151798915 TGGTGAGAGGTGAGGAGGGAGGG - Intronic
1034704759 7:153130680-153130702 AGGTGTTAGGTGAGAAGGGAGGG - Intergenic
1035133239 7:156675238-156675260 AGGGGTGAGCTGAGGGTGGTCGG + Intronic
1035520324 8:271012-271034 CTCTGTGTGGTGAGGCTGGAGGG - Intergenic
1035786733 8:2266931-2266953 AGGGGTGAGGTGTGGAGGGAGGG + Intergenic
1035806074 8:2454785-2454807 AGGGGTGAGGTGTGGAGGGAGGG - Intergenic
1035971900 8:4258377-4258399 AGGAGGGAGGGGAGGATGGAAGG + Intronic
1036162984 8:6406507-6406529 AGGTGAGGCGGGAGGCTGGAGGG - Intergenic
1036786587 8:11692088-11692110 AGGTGACAGGTGAGGCAGGCAGG + Intronic
1036955073 8:13179268-13179290 AGGTGGGGGGTGGGGCAGGAAGG + Intronic
1037671238 8:21016980-21017002 AGGTGTCAGGAGAGGGTTGACGG + Intergenic
1038154829 8:24979490-24979512 TGGTGTGAACTGAGGCTGGGGGG - Intergenic
1038394519 8:27237054-27237076 AGGTGGCAGGTGAGGCTGGCAGG + Intronic
1038584524 8:28777156-28777178 AGGAGTGAGATGAGGGTGGAGGG - Intronic
1039330326 8:36530601-36530623 GGGTGTGGGGTAATGCTGGAAGG + Intergenic
1039471193 8:37814699-37814721 AGGTCTGACGTGGGGCTGGGTGG + Intronic
1039773080 8:40708311-40708333 AGGTCTGTGGAGAGCCTGGAGGG + Intronic
1040648662 8:49426639-49426661 TGGTGAGAGGTGAAGCTGGCTGG + Intergenic
1040984701 8:53280851-53280873 GGGTGGGAGATGAGGCTGGAGGG + Intergenic
1041584386 8:59499073-59499095 AGGATAGAGGTGGGGCTGGAGGG - Intergenic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042207625 8:66345061-66345083 GGGTCTGAGGTGAGGGTGGGAGG - Intergenic
1043058389 8:75469110-75469132 AGGTCTGAGGTGCAGGTGGAAGG + Intronic
1043070880 8:75634589-75634611 TGGTGTGGGGGGAGGCAGGAGGG - Intergenic
1043097733 8:75996962-75996984 TGGTGAGAGGTGAAGCTGGCTGG + Intergenic
1043690062 8:83140253-83140275 AAGTGAGAGGTGAAGCTGGTTGG - Intergenic
1043874058 8:85464543-85464565 AGGGGTGGGGTGGGGGTGGAAGG - Intronic
1044823792 8:96177648-96177670 AGGTGAGAGGAGAGTCTTGATGG + Intergenic
1045016066 8:98002985-98003007 AGGAGAGAGATGAGGCTGGGAGG - Intronic
1047094217 8:121606804-121606826 AGGATTGAGCTGAGGCTGAAGGG + Intergenic
1047224326 8:122943791-122943813 AGGTGTGGGGTGGGGCTGGCGGG - Intronic
1048986101 8:139735912-139735934 AGGTGTGAGGCCAGGGTGGTAGG + Intronic
1049199545 8:141333306-141333328 TGGAGGGAGGTGAGGCTGGAGGG + Intergenic
1049376502 8:142291874-142291896 AGGTGTGGGGTGAGGAATGAGGG + Intronic
1049513083 8:143039561-143039583 AGCTGTGAGGTGAGGTGGGGAGG + Exonic
1049873678 8:145001403-145001425 AGGAGTGAGGTTGGGCTGGCTGG + Intergenic
1049989734 9:979257-979279 AGGAGTGAGGGCAGGCAGGAAGG + Intronic
1051057380 9:13003968-13003990 AGGTGTGAGCCCAGGCTGGAGGG - Intergenic
1051589917 9:18767111-18767133 AGGTTTGGGATGAGGTTGGAAGG + Intronic
1051850672 9:21503845-21503867 CGGTGGGAGGTGAAGCTGAAAGG + Intergenic
1053296108 9:36913859-36913881 AGGAGAGAGGTGGGGCCGGAAGG + Intronic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1055685358 9:78767597-78767619 ACCTGTGAGATGAGGCTGGCCGG + Intergenic
1056714781 9:89020292-89020314 GGGTGAGAGGTGAAGGTGGAGGG + Intronic
1057501211 9:95597819-95597841 AGGTTTGCGGGGAGACTGGATGG + Intergenic
1057747369 9:97762795-97762817 TGGTGAGAGATGAGGCTGGGAGG - Intergenic
1057750888 9:97792043-97792065 AGGTGAGAGTTGATGTTGGATGG + Intergenic
1057820671 9:98328139-98328161 GTTTGTGAGATGAGGCTGGAGGG - Intronic
1057829400 9:98395401-98395423 AGGGGAGAGGTGTGGCTGGGGGG + Intronic
1058433040 9:104935965-104935987 AGGGGTGGGGTGTGGATGGATGG - Intergenic
1058989589 9:110242141-110242163 ATGAGTGAGGTGAGGATGGGAGG - Intergenic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1059349858 9:113656875-113656897 AGGGGTGAGGTGGGCCTGGAAGG + Intergenic
1059446852 9:114343402-114343424 AGGGGTGAAGGGAGGATGGAGGG + Intronic
1059506067 9:114800987-114801009 AGGCATGAAGTGAGGTTGGAGGG + Intronic
1060146753 9:121259603-121259625 GGGGATGAGATGAGGCTGGAGGG + Intronic
1060246354 9:121949975-121949997 GAGTGTGAGTAGAGGCTGGATGG - Intronic
1060375389 9:123112069-123112091 AGGTGTGGGGAAAGGCGGGAGGG - Intronic
1060553133 9:124495102-124495124 AGAGGTGAGGTGTGGATGGAGGG - Intronic
1060716498 9:125935043-125935065 ATGTGTGAGATGAGTCTGGAAGG - Intronic
1060828749 9:126700926-126700948 AGGTGGAAGGTGAGAGTGGAGGG - Exonic
1061035185 9:128109538-128109560 AGGAGCGGGGTGAGGCTGGGAGG - Intergenic
1061279060 9:129586690-129586712 AGGGGAGAGGGGAGGCCGGATGG - Intergenic
1061592082 9:131604094-131604116 AGCTGTGAGGGCCGGCTGGAGGG - Intronic
1062345826 9:136114737-136114759 AGGTGGGACGGGAGGCGGGAGGG - Exonic
1062415601 9:136447805-136447827 GGGTGTGAGGTGTGAGTGGAGGG - Intronic
1062425366 9:136503732-136503754 GGCTGTGTGGTGAGGCTGGCTGG + Intronic
1062606055 9:137349348-137349370 AGGTGTGCGGTGCGGCGGGTGGG - Exonic
1062656578 9:137606837-137606859 TGGTGTGTGGTGAGGCCGGCTGG + Intronic
1185672983 X:1826490-1826512 CCAGGTGAGGTGAGGCTGGATGG - Intergenic
1185673077 X:1826892-1826914 AAGTTGGAGGTGAGTCTGGATGG - Intergenic
1186038658 X:5452291-5452313 AGGTGGGTGGTGAGGCTGGAAGG + Intergenic
1186294141 X:8130605-8130627 GGCTGTGAGATGAGTCTGGAAGG - Intergenic
1186818373 X:13260586-13260608 AGGTGGGAAGGGAGGTTGGAGGG - Intergenic
1187657188 X:21489805-21489827 AGGTGGTAGGTGGGGGTGGAGGG + Intronic
1187968925 X:24640198-24640220 TGGTGGGAGCGGAGGCTGGATGG - Intronic
1188050024 X:25473403-25473425 AGGTGTGAAGAGAGTCTAGATGG - Intergenic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1188726284 X:33587288-33587310 AGATGTGAGATGAGACTGGAGGG - Intergenic
1188844874 X:35060043-35060065 AGGCTTGAGGTGGGGCTGTAGGG + Intergenic
1189297643 X:39930088-39930110 GGCTGAGAGGTGAGGCAGGAGGG + Intergenic
1190558618 X:51664699-51664721 AGGTGTGAGGTTGGGGTGGGGGG - Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1192029537 X:67494347-67494369 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1192210767 X:69126417-69126439 AGGGCTGAGGTGAGGATGAAGGG - Intergenic
1193348674 X:80432322-80432344 AGCTGTCACGTGAGGCCGGAAGG - Intronic
1193584323 X:83301739-83301761 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1193801547 X:85942901-85942923 AGGGGTGAGGGGAGGGGGGAGGG - Intronic
1194739748 X:97558485-97558507 AGGTAGGAGATGAGGCTGGGGGG + Intronic
1195227704 X:102815355-102815377 AGGTGGGAGATGAGGTTGAAAGG + Intergenic
1196799799 X:119532378-119532400 AGGTGAGAGGTGAGAATGGTTGG - Intergenic
1196871416 X:120116242-120116264 AGATGGGAGGTGTGGGTGGAGGG + Intergenic
1198050422 X:132946617-132946639 TGGGGTGAGGGGAGGCGGGAGGG + Intronic
1199209208 X:145187131-145187153 TGTTATGAGGTGAGGCTGAAAGG + Intergenic
1199565036 X:149206911-149206933 AGCTGTGAGATGAGAATGGAAGG + Intergenic
1199817577 X:151412403-151412425 TGGTCTGAGGTGAGTTTGGAAGG - Intergenic
1200136890 X:153879604-153879626 AGCTGTGAGCTGGGGCCGGAGGG + Intronic
1200379097 X:155815513-155815535 AGGTATGAGGTTAAGCTTGAGGG - Intergenic