ID: 920029881

View in Genome Browser
Species Human (GRCh38)
Location 1:203030444-203030466
Sequence GGGTGACCCCAGAAATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920029874_920029881 10 Left 920029874 1:203030411-203030433 CCGTGAGGAGTGGGCATTTTGGG 0: 1
1: 1
2: 1
3: 25
4: 308
Right 920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG 0: 1
1: 0
2: 0
3: 17
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920029881 Original CRISPR GGGTGACCCCAGAAATCTCA TGG Intronic
901849201 1:12004736-12004758 AGGTGACCCCAGAAGGCTGACGG - Intronic
902146527 1:14405742-14405764 TGGAGACCCCAGAAAGCCCATGG + Intergenic
902222131 1:14973029-14973051 GGGTGACCCCATCTATGTCATGG - Intronic
902742929 1:18452484-18452506 AGATCAACCCAGAAATCTCAGGG + Intergenic
902827689 1:18988226-18988248 GGGTGACCCCACAAGTCTAGAGG + Intergenic
904972143 1:34427500-34427522 GGGTGACCTCAGGAAGCTCAGGG - Intergenic
905322029 1:37124667-37124689 GGGAGAACCCAGAACTCTCACGG - Intergenic
905940994 1:41863248-41863270 GGGTGATCCCAGTAATGTGAGGG + Intronic
907562270 1:55401989-55402011 GGTTGTCCCCAGATAACTCAGGG + Intergenic
907950490 1:59178675-59178697 GGGAGAGCCAAGAGATCTCAAGG + Intergenic
909801616 1:79817064-79817086 GGGTGACTCTAGAAGTCACATGG - Intergenic
915986865 1:160474834-160474856 GGGTGATCTCACTAATCTCATGG + Intergenic
920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG + Intronic
922828701 1:228539440-228539462 GGGTGACCCCAGGAATTGTAAGG - Intergenic
923253098 1:232195129-232195151 GGGAAACCACAGAAATCTTAGGG - Intergenic
924553802 1:245102130-245102152 TGGAGACCACAGAAATCTCTGGG + Intronic
924648821 1:245904766-245904788 GGGTGACGCCAGCACTCTCTCGG - Intronic
1062844864 10:696137-696159 GCGGGTCCCCAGAAATCACAAGG - Intergenic
1074489628 10:113927592-113927614 GGATTTTCCCAGAAATCTCAGGG + Intergenic
1077296039 11:1826705-1826727 GGGTGACCCCAGGAATCCCCAGG + Intergenic
1077546033 11:3170447-3170469 GATACACCCCAGAAATCTCACGG + Intergenic
1077940243 11:6833367-6833389 CGGTGAGCCCAGAAACATCAGGG + Intergenic
1079143177 11:17827589-17827611 GGGTGCCCTCAGAAATCCCTCGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084935929 11:72586602-72586624 CGGTGCCTCCAGAAATCTTAGGG + Intronic
1087295495 11:96368235-96368257 GGGTCACCCAAGAATTCTGATGG - Intronic
1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG + Intergenic
1097233172 12:57524170-57524192 GGGAGACCCAAGAAAACTCAGGG - Intronic
1104655068 12:130568231-130568253 GGGAGACCCAGGATATCTCAGGG + Intronic
1107155514 13:37162687-37162709 AGGTGACCTCAGAATTCTGAAGG + Intergenic
1107338903 13:39385313-39385335 GGGTGAACCCAAAAACCGCAGGG - Intronic
1112652350 13:101413966-101413988 GCGTGAGCCCAGAGATGTCAAGG - Intronic
1113650489 13:112030978-112031000 GCGTGTCTCCAGCAATCTCATGG - Intergenic
1114661359 14:24347255-24347277 GGGTGACCCCAGGAATCAGAAGG - Intergenic
1118629790 14:67692193-67692215 AGCTGAAGCCAGAAATCTCATGG - Intronic
1119256777 14:73205030-73205052 GGTTGACCTCAGAAATAACAAGG + Intronic
1119756351 14:77122698-77122720 GGGTGAGCTCAGAAGTCTGAAGG - Intronic
1120317755 14:82917653-82917675 GGTTAACCCCAGGTATCTCAGGG + Intergenic
1122357356 14:101131747-101131769 GTGTGCCCCCAGGAACCTCAGGG + Intergenic
1123403747 15:20008796-20008818 TGGTGGCCCCAGAAAACTCATGG - Intergenic
1123513086 15:21015442-21015464 TGGTGGCCCCAGAAAACTCATGG - Intergenic
1125953733 15:43775697-43775719 GGGTGAGGCCAGAAATTGCAGGG - Intronic
1126462005 15:48924371-48924393 GGGTGACCCCAGGGAGCTTAGGG - Intronic
1128678939 15:69632631-69632653 TGGTAACCCTAAAAATCTCAGGG + Intergenic
1129698710 15:77755237-77755259 AGGTGACCCCAGGGATCTGATGG + Intronic
1135162464 16:20109375-20109397 GGGGCACCCCAGAAATTGCAAGG + Intergenic
1136567272 16:31077905-31077927 GGGTGCCCCCAGCCACCTCAAGG + Exonic
1137049373 16:35694805-35694827 GGGCGACCCCAGCATTCTAATGG - Intergenic
1137723688 16:50642706-50642728 ATGTGACCCCAGAAGGCTCATGG + Intergenic
1140492412 16:75349242-75349264 GGGTCACACCTGTAATCTCAAGG + Intronic
1142286753 16:89174637-89174659 CGGTGGCCCCAGACGTCTCAAGG + Intronic
1145283757 17:21488220-21488242 GGGTGTCCCCAGAAATGTGTGGG + Intergenic
1145393683 17:22477279-22477301 GGGTGTCCCCAGAAATGTGTGGG - Intergenic
1145783940 17:27582069-27582091 GGGTGACCTCAGAAACCGAAGGG - Intronic
1145965724 17:28915551-28915573 GGGTGATCTCAGAAAGCCCATGG - Intronic
1148493874 17:48040337-48040359 GGGTCACACCTGTAATCTCAGGG - Intergenic
1148963769 17:51417111-51417133 GGGTTCCCTCAGAAGTCTCAGGG + Intergenic
1152441526 17:80312817-80312839 GGGTGAACCCAGAAAACCCTGGG + Intronic
1153544155 18:6188804-6188826 GGGAGACCCCTGTAATCTCCTGG + Intronic
1157278745 18:46332278-46332300 GGCTGCCCCCAGAGAACTCAGGG - Intronic
1157744167 18:50120404-50120426 GGGTGACCCCTCAATTCTCAGGG + Intronic
1159925520 18:74265742-74265764 GGGGGAGCCCACACATCTCATGG + Intronic
1160682345 19:417652-417674 TGGTGACCCCAGAAATAACCTGG - Intronic
1161098058 19:2405216-2405238 GGGAGACCCCAGAAGAGTCAGGG + Intronic
1163629894 19:18412943-18412965 AGGTGACCCCAGGAAGCTCCTGG + Intergenic
1164384425 19:27760994-27761016 GGGTGATCCCAGCATTCTAATGG - Intergenic
1164948831 19:32318960-32318982 GGGTGACCACAGTATTTTCAGGG - Intergenic
928170345 2:28999305-28999327 TGGTCACCCCAGGAACCTCAGGG + Exonic
929013089 2:37467228-37467250 TGGAGACCACATAAATCTCATGG - Intergenic
931246634 2:60497950-60497972 GGATGACCCCATAAAGGTCAGGG + Intronic
932769950 2:74495326-74495348 GGGTGAGCAAAGAACTCTCAGGG - Intergenic
935447228 2:103169389-103169411 GAGTGACCCCAAAAGGCTCAGGG + Intergenic
936798219 2:116233219-116233241 TGGTTACCCAAGAACTCTCAGGG + Intergenic
936903832 2:117514061-117514083 GAGTTACCCAAGAAAACTCAAGG + Intergenic
938403067 2:131010081-131010103 GGCTGACCCCTGAATTCTGAAGG - Intronic
938576025 2:132605583-132605605 GGGTGCCCGCAGGAATCTCATGG + Intronic
942055917 2:172181946-172181968 GGCTGAGCACAGAGATCTCAGGG + Intergenic
943305587 2:186257496-186257518 GGGTGACCTCAGTAATTTCAAGG + Intergenic
943633498 2:190280308-190280330 GGTTGAGCCCAGAAAGCTCTAGG - Intronic
945729285 2:213513506-213513528 TGGTGACCCATGGAATCTCAGGG + Intronic
946076662 2:217079320-217079342 GGGTAACCCCAGAGATGTGACGG - Intergenic
947529673 2:230900885-230900907 GGGTGACCCCATAAAGCTGGAGG - Intergenic
948348676 2:237320779-237320801 GGAAGACCCCAGGAATCCCATGG + Intergenic
1169191054 20:3659628-3659650 GGGAGACCCCAGTGGTCTCAAGG + Intronic
1170593786 20:17790725-17790747 GGGTGACCACTGACATCTCCAGG - Intergenic
1171189728 20:23150602-23150624 AGGTGCCCCCAGAGATCTCAGGG + Intergenic
1173474962 20:43352502-43352524 AGGTGATCCCAGAAAGCACAGGG + Intergenic
1173803730 20:45911078-45911100 GCGGGGCCCGAGAAATCTCAGGG - Intronic
1176151826 20:63595455-63595477 GGCTGATCCCAGACAACTCAGGG + Intronic
1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG + Intergenic
1178247192 21:30964716-30964738 AGGGGAGACCAGAAATCTCAGGG + Intergenic
1180786416 22:18550154-18550176 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181131696 22:20735873-20735895 GGGGGACCCCAGAACTGCCATGG + Intronic
1181243337 22:21489707-21489729 GGGGGACCCCAGAACTGCCACGG + Intergenic
1183333884 22:37235823-37235845 GGGTCATCCCTGGAATCTCAGGG + Intronic
1184861031 22:47173422-47173444 GGGTGACCCCAGAAAACTGGAGG - Intronic
950876325 3:16277915-16277937 GAGTAACCCTAGAAATGTCAAGG + Intronic
956749111 3:72332159-72332181 AGGTGACCCCAGGAAACTCTGGG - Intergenic
960490714 3:118313915-118313937 GGGTGAGCCTAGAAATGTCCAGG - Intergenic
962897726 3:139731054-139731076 GGGTGCCCCATGACATCTCAGGG + Intergenic
964640641 3:158906624-158906646 GGGTGAGCCCAGACATCAGAAGG - Intergenic
968952369 4:3701713-3701735 GGGTGACCCCAGCAACAGCAGGG - Intergenic
969428101 4:7137726-7137748 GGGTGGCCCCAGTCATCTCTGGG - Intergenic
970458432 4:16248511-16248533 GGATGACCTCAGAAATCTGAAGG + Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
974021402 4:56694357-56694379 GGGAGATCTCAGAAATCTTAAGG + Intergenic
974910995 4:68119730-68119752 GGGTCACCCCAGAGCTCTGAAGG + Intronic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
979201786 4:117987409-117987431 TGAGGACCACAGAAATCTCATGG + Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
985553058 5:543013-543035 AGGTGACCCCAGACACATCAGGG - Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
992881840 5:81118013-81118035 GGCTGAGCCCAGAAAAGTCATGG - Intronic
994082902 5:95728217-95728239 GTATGACTCCAGAAATCTCTTGG + Intronic
995710770 5:115033252-115033274 GGGTGCCACCTGAAATCTCATGG - Intergenic
996926261 5:128830081-128830103 GGGAAACCCCAGCAATCCCAGGG + Intronic
999049622 5:148508373-148508395 GGGTGACCAGAAAAGTCTCAGGG + Intronic
999394509 5:151218613-151218635 GGCTGCCCCCTGACATCTCAGGG - Intronic
1007291957 6:40794330-40794352 GGGTGGCCACAGAAATCTTCTGG + Intergenic
1007740479 6:44006565-44006587 GGCTGACCCCAGGAAGCCCAAGG + Intergenic
1015938828 6:138429609-138429631 GGGTGACAGAAGAAACCTCAAGG + Intronic
1016980240 6:149847058-149847080 GGGTGACGCCAGCAGCCTCATGG - Intronic
1019049543 6:169172497-169172519 GGGTGACCCCACCGATGTCACGG - Intergenic
1019716932 7:2543442-2543464 GGGTGACCCTGGAACCCTCATGG - Intronic
1019989837 7:4683180-4683202 GGGTGACCCCAGGAGCCGCAAGG - Intronic
1020639724 7:10740532-10740554 GGGCAACTCCAGATATCTCACGG + Intergenic
1026682325 7:72476463-72476485 AGGTCACCCCAGAAGTCCCAGGG - Intergenic
1028190433 7:87844246-87844268 GGGTTACCCCAGAAATGCAAAGG + Intronic
1031028283 7:116705908-116705930 GGGTGTGCCCAGTGATCTCAGGG - Intronic
1034166174 7:149026861-149026883 GGGTGAGCCTAGGAATCCCAGGG - Intronic
1034314101 7:150113653-150113675 GGGTGATGCCATAAAACTCAGGG + Intergenic
1034792799 7:153987144-153987166 GGGTGATGCCATAAAACTCAGGG - Intronic
1034908570 7:154973107-154973129 GGCTGACCCCAGCGCTCTCATGG + Intronic
1035022459 7:155807599-155807621 GGGTGACCCCAGAATTCCAGGGG - Intronic
1035457124 7:159015895-159015917 GGCTGTCCCCAGACACCTCAAGG + Intergenic
1036063287 8:5350176-5350198 CACTGACCCCAAAAATCTCATGG + Intergenic
1036249819 8:7152179-7152201 GGCTGACCACAGATATATCAGGG - Intergenic
1036454431 8:8894320-8894342 GGGTGTCCCCGGAATTGTCATGG - Intergenic
1037127292 8:15366514-15366536 GGGAGACCAGAGGAATCTCATGG + Intergenic
1037278716 8:17211410-17211432 GAGTGACCCCATAAACCTCAAGG + Intronic
1039094447 8:33868413-33868435 GTGTGACCCAAGATACCTCAAGG + Intergenic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1043087079 8:75848839-75848861 TGGAGACCTCAGGAATCTCAGGG + Intergenic
1044774727 8:95676412-95676434 GTGTGACCCAACAAATCTGATGG + Intergenic
1047906103 8:129474880-129474902 TGGTGAGTCCAAAAATCTCAGGG + Intergenic
1049408184 8:142460877-142460899 GGGTGACCCCAGCACTGCCAGGG + Intronic
1049423218 8:142525930-142525952 GGGAGACCCCAGGATGCTCAGGG + Intronic
1050399112 9:5231867-5231889 GGGTCTCACCAGAAATCTCATGG + Intronic
1051809768 9:21035354-21035376 GAGTGACCTCTGAAAACTCAAGG - Intergenic
1051923863 9:22299480-22299502 GGGTGATGCCAGAACTCTCTTGG + Intergenic
1052162472 9:25282741-25282763 GTGAGCCCCCAGAAATATCATGG - Intergenic
1052362455 9:27575496-27575518 GGGAGACCCCAGACTTCACATGG + Intergenic
1053142027 9:35688484-35688506 GGGTGGGCAGAGAAATCTCAGGG + Intronic
1053270903 9:36748866-36748888 GTGTGACCTCAGATGTCTCATGG + Intergenic
1055931671 9:81565670-81565692 GGGTGTTCCCAGTGATCTCAAGG + Intergenic
1056871674 9:90287686-90287708 GGGAATCCCCAGAAAGCTCAGGG + Intergenic
1057836398 9:98448864-98448886 GGGTGACCTCCCAGATCTCAAGG - Intronic
1058673986 9:107384993-107385015 GGGTGAGCCCACCAATCTCCTGG - Intergenic
1059280524 9:113129680-113129702 GGGAGAGCCCAGAAATATTAAGG - Intergenic
1059427532 9:114230571-114230593 TGTTGATCCCAGAAATCCCAGGG - Intronic
1060458612 9:123826091-123826113 AAAGGACCCCAGAAATCTCAGGG - Intronic
1060856145 9:126915572-126915594 GGATGCCCCCAGAATCCTCAGGG - Intronic
1061066378 9:128280300-128280322 GGGTGTCCCAAGAAAGGTCAGGG - Intronic
1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG + Intergenic
1062682136 9:137787799-137787821 GGGTGGCCCCTGAAACCTGAGGG - Intronic
1191244525 X:58215479-58215501 GGGTGACCTCAGAAATTCTAAGG + Intergenic
1191248017 X:58243303-58243325 GGGTGACCCCAGACATTCTAAGG + Intergenic
1194967245 X:100302597-100302619 AGGTGACCCTACAAATCTGAGGG - Intronic
1197121652 X:122900156-122900178 TTGTGACCCCAGAAGTCCCATGG + Intergenic
1199400268 X:147390321-147390343 TGGTACCCCCAGAAATCTAATGG + Intergenic