ID: 920032849

View in Genome Browser
Species Human (GRCh38)
Location 1:203047992-203048014
Sequence AAGGCTAGGCCTGAGCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920032849 Original CRISPR AAGGCTAGGCCTGAGCGAGG AGG Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900719503 1:4166291-4166313 AAGGGTTGGCCCGAGAGAGGAGG - Intergenic
901101335 1:6721347-6721369 AAGACTAGGCCCGGGCGTGGTGG - Intergenic
902192177 1:14771536-14771558 TAGGATAGGCCTGGGCGAGGTGG + Intronic
902677164 1:18016792-18016814 AAGGATTGGCCTGTGCGAGATGG - Intergenic
903349962 1:22711360-22711382 AAGACCAGGCCGGCGCGAGGCGG - Intronic
903841922 1:26249011-26249033 ATGTCTAGGCCTGGGCGTGGTGG - Intronic
904161666 1:28526606-28526628 AAGGATAGGGCTGGGCGCGGTGG + Intronic
904927047 1:34057553-34057575 AAGGCTGAGCCAGAGAGAGGTGG + Intronic
907447776 1:54519997-54520019 AGGGCCTGGGCTGAGCGAGGTGG - Intergenic
910464416 1:87481652-87481674 AAGACTAAGACTGAGCGTGGTGG + Intergenic
912702165 1:111886493-111886515 AAGGCTTGTCCTGTGCGAGGAGG + Intronic
915167108 1:153954111-153954133 AACGCCAGGGCTGAGAGAGGTGG - Intronic
916797293 1:168178985-168179007 GAGGCTGGGCCGGAGGGAGGCGG + Exonic
917344923 1:174020719-174020741 AAGTTTAAGGCTGAGCGAGGTGG + Intronic
920032849 1:203047992-203048014 AAGGCTAGGCCTGAGCGAGGAGG + Intronic
920092819 1:203466160-203466182 AAGGCTAGGGCTGTGCACGGGGG + Intergenic
920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG + Intronic
920825869 1:209423846-209423868 TAGGTTAGGCCTGGGTGAGGGGG + Intergenic
922766282 1:228158196-228158218 CATGCTGGGCCTGGGCGAGGAGG + Exonic
923505956 1:234607478-234607500 AAGGCTGGGCCCCAGAGAGGTGG - Exonic
1064272471 10:13877915-13877937 AAGGTCAGGCCTGAGAGGGGTGG + Intronic
1066308023 10:34166323-34166345 AAGCTCAGGCCTGGGCGAGGTGG + Intronic
1067054073 10:43041145-43041167 AAGTCCAGGCATGAGTGAGGAGG + Intergenic
1067788417 10:49269998-49270020 AAGTCTAGGACTGAGGGAGTGGG - Intergenic
1070780720 10:79136061-79136083 AAGGCCAGGCCTGGGGGAGGAGG - Intronic
1071569127 10:86686970-86686992 AAGGCAAGGGCTGGGCGCGGTGG - Intronic
1071739134 10:88337021-88337043 AAGGCTGGGCCTGAGAGATGGGG + Intronic
1072722216 10:97788025-97788047 AAGGCTGGGGCTGAAGGAGGAGG - Intergenic
1075697301 10:124446778-124446800 CAGGCTATTCCTGAGAGAGGGGG - Intergenic
1076988068 11:253669-253691 CAGGCGAGGCCTGGACGAGGTGG - Intergenic
1081713092 11:45230525-45230547 AAGGCTGGGGCTGGGCCAGGTGG - Intronic
1083802807 11:65056692-65056714 AAGGCTGGGCATGGGCGTGGTGG - Intronic
1084008584 11:66335673-66335695 AAGGAGACGCCTGAGAGAGGAGG + Exonic
1089070359 11:115695368-115695390 AATGCAAGGCCAGAGCCAGGAGG + Intergenic
1089850110 11:121488298-121488320 AAGGCTAGGCCCAAGAGAGAAGG - Intronic
1090785180 11:130042360-130042382 GAGGCTAAGCGTGAGAGAGGCGG + Intergenic
1091218667 11:133918402-133918424 CAGGCGAGGCCGGAGCGTGGGGG + Intronic
1092130782 12:6111628-6111650 ACTGCTAGGCCAGAGCGGGGTGG - Intronic
1096092755 12:48914224-48914246 ATGGCAAGGGCTGAGCAAGGTGG - Intronic
1096197068 12:49655630-49655652 AAGGCCATGCCTGAGACAGGAGG + Intronic
1097229268 12:57499306-57499328 AAGGCTGGGGCTGGGCGCGGTGG + Intronic
1099361058 12:81702389-81702411 AAAGCTAGGTCAGAGCGAAGTGG - Intronic
1102092861 12:110207804-110207826 AAGGCTGGGGCTGGGCGCGGTGG - Intronic
1102587375 12:113932809-113932831 AGGGCTAGGCCTGGGGGCGGGGG + Intronic
1102791031 12:115645737-115645759 AAGGGTAGGCCTGGGCATGGTGG + Intergenic
1103728480 12:123010894-123010916 CAGGCTAGGCCTGAGAGCAGGGG + Intronic
1105641615 13:22270768-22270790 AAGGATAGGTTTGAGGGAGGAGG - Intergenic
1108086310 13:46797026-46797048 ACGGCTAGGCGTGATCGGGGCGG - Intronic
1108700045 13:52936018-52936040 AAGGCTTGGGCTGAGCACGGTGG + Intergenic
1112392901 13:99001638-99001660 AAGCCTATGGCTGAGAGAGGAGG + Intronic
1113420122 13:110164834-110164856 AAGGCTTGGCCTGTGCAGGGCGG - Intronic
1113937464 13:114001959-114001981 GATGCAAGGCCTCAGCGAGGAGG + Intronic
1116093180 14:40334756-40334778 GAGGCTATGCATGAGCCAGGGGG + Intergenic
1117367450 14:55043444-55043466 AAGGCTAAATCTGATCGAGGTGG - Exonic
1117642092 14:57810725-57810747 AAGGCCAGGCCTTAGCTTGGAGG + Intronic
1118314488 14:64717283-64717305 GAGGCGAGGCCTGAGGGAGGGGG + Intronic
1118462786 14:66002157-66002179 AAGGCCAGGCCTGGGCGTAGAGG + Intronic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1120943434 14:89971226-89971248 AAGGCTTGGCCTGGGCATGGAGG - Exonic
1121971958 14:98366596-98366618 AAGGCAAGGCCTGGGCAAAGGGG + Intergenic
1122650903 14:103226526-103226548 AAGGCTGGGCCTGAGTGAAGAGG - Intergenic
1122901529 14:104784178-104784200 AAGGCCAGCCCTGGGCCAGGTGG + Intronic
1124388886 15:29235136-29235158 ATGGCTCTGCCTGAGCGAGGTGG + Intronic
1126523984 15:49629817-49629839 ATTGCTAGGCCTAAGCGGGGAGG + Intronic
1127573928 15:60271966-60271988 AAGGCCAGGGCTGGGCGTGGTGG - Intergenic
1128226305 15:66003759-66003781 AAGGCTGGGCCTGAGCACTGAGG - Intronic
1128758834 15:70201094-70201116 GAGCCTGGGCCTGGGCGAGGGGG + Intergenic
1130862162 15:87900802-87900824 AAGGCCAGGGGTGAGCCAGGAGG - Intronic
1130907736 15:88252159-88252181 AGGACTAGGTCTGAGAGAGGTGG - Intronic
1131096129 15:89655312-89655334 AGGCCCAGGCCTGCGCGAGGAGG + Intronic
1132669799 16:1097919-1097941 CAGGCCAGGCCTGAGTGGGGTGG + Intergenic
1132748396 16:1446401-1446423 GAGGCTGGGCCTGCGCAAGGAGG + Exonic
1134125567 16:11613649-11613671 AAGGCTAAGCCAGAGTTAGGTGG + Intronic
1136356037 16:29745382-29745404 AAGGGTAAGCGTGAGCCAGGTGG + Intronic
1137613726 16:49835235-49835257 AAGGCCAGGGCTGAGCCAGGGGG - Intronic
1140859984 16:79010110-79010132 AAGTCTAGGCATGAGTAAGGTGG - Intronic
1142221666 16:88857834-88857856 AAGGCTAAGACTGAGCTGGGTGG + Intronic
1144050695 17:11495062-11495084 CAGGAAAGGCCTGAGCAAGGTGG + Intronic
1145413711 17:22695286-22695308 AAGGCCAAGCCGGAGGGAGGCGG - Intergenic
1145414457 17:22703479-22703501 AAGGCAAAGCCAGAGGGAGGCGG + Intergenic
1147735739 17:42636935-42636957 AAAGTTAGGGCTGGGCGAGGTGG + Intergenic
1148556037 17:48578943-48578965 AAGGGTAGGGGTGAGAGAGGAGG + Exonic
1148716807 17:49721800-49721822 AAGGCTAGGGCTGGGCGTGGTGG + Intronic
1151389886 17:73779180-73779202 AAGCAGAGGCCTGAGTGAGGTGG - Intergenic
1151617604 17:75224543-75224565 AAAGCTGGGGCTGAGCGTGGTGG + Intronic
1152460811 17:80441437-80441459 AAGGCAAGGCCTGGGAGAGATGG - Intergenic
1155241856 18:23871544-23871566 AAGGCTCACCCTGAGCGAGGTGG + Exonic
1157209038 18:45725574-45725596 AGGGCTAGGACTTAGCGATGCGG - Intronic
1162478616 19:10915402-10915424 GAGGCCAGGCCTGTGCAAGGAGG + Intronic
1163035696 19:14567661-14567683 GAGGCTGGGTCTGAGGGAGGCGG - Intronic
1163671202 19:18629681-18629703 AAAGCTGGGGCTGAGCCAGGAGG - Intergenic
1163675359 19:18653126-18653148 AAGGCTCTGCCTGAGCCTGGAGG + Intronic
1163675929 19:18655288-18655310 AAGGCTCTGCCTGAGCTGGGAGG - Intronic
1165094558 19:33403113-33403135 AAGGCTGGGCCTGGCTGAGGGGG + Intronic
1165263870 19:34644319-34644341 AAGGCTGGGGCTGGGCAAGGTGG - Intronic
1165819425 19:38665211-38665233 AAGGCTGGGCCAGAGCATGGAGG + Intronic
1165941582 19:39417134-39417156 AAAGCTAGGGCTGTGCGCGGTGG - Intronic
1166050314 19:40255343-40255365 GGGGCTAGGCCTGTGGGAGGTGG - Intronic
1166211252 19:41308030-41308052 CAGGCCAGGCCTGAGGCAGGTGG - Intronic
1166679002 19:44756343-44756365 GAGGCTCGGTCTGAGGGAGGAGG + Intronic
1167768325 19:51499038-51499060 AAGGCTGAGGCTGAGGGAGGGGG + Intronic
925793621 2:7519275-7519297 CAGGCTAGGCCTAAGAGATGAGG + Intergenic
927416133 2:22882544-22882566 ACGGCTAAGCCAGAGGGAGGTGG - Intergenic
928723701 2:34147979-34148001 AAGGTTGGGGCTGAGCCAGGGGG - Intergenic
931765586 2:65453188-65453210 AAGGCAAGGAATGAGCCAGGAGG + Intergenic
938302674 2:130228230-130228252 AGGGCTAGGCCTGAGGGGGGAGG - Intergenic
938581595 2:132651432-132651454 AGGTCTGGGCCTGAGGGAGGAGG + Intronic
945042649 2:205755113-205755135 AAGGCCAGGACTGGACGAGGAGG - Intronic
945227074 2:207542847-207542869 AAGGGAAGGCCTGAGGTAGGTGG - Intronic
947447980 2:230179310-230179332 AAGGCTAGGCATGGGGGTGGAGG + Intronic
947593821 2:231398993-231399015 AAGGCTAGGCCTGGGCACTGTGG - Exonic
1171322390 20:24257952-24257974 AAGGAGGGGCCTGAGCGATGGGG + Intergenic
1171499813 20:25585116-25585138 AAGGCTCGGCCTGAGGCGGGCGG - Intronic
1171816261 20:29788331-29788353 AAGGCTATGACTGAACTAGGAGG - Intergenic
1172099276 20:32475586-32475608 AAGGCTGGGCCTGGAGGAGGTGG - Intronic
1172244057 20:33433667-33433689 AAGGCCAGGCCTGGGGGAAGAGG - Intronic
1174289804 20:49500010-49500032 AAGGCTGTGGCTGAGTGAGGGGG - Intergenic
1174457280 20:50658418-50658440 AATGGTTGGACTGAGCGAGGTGG + Intronic
1174826821 20:53776089-53776111 AAGGCTATGGCCGGGCGAGGTGG + Intergenic
1179654113 21:42834559-42834581 AGGGCTCGGGCTGACCGAGGAGG + Intergenic
1183087456 22:35495256-35495278 AAGGCTTGGCCCCAGCGAGATGG + Intergenic
1183872091 22:40747734-40747756 AGGGCAAGGCATGAGGGAGGGGG + Intergenic
1185215127 22:49594375-49594397 AAGGCTGGCCCTGAGGGAGCTGG - Intronic
1185253223 22:49816609-49816631 AAGGCTGGGGCTGGGCGAGGTGG + Intronic
952970494 3:38647872-38647894 AAGCCTAGAACTGAGCCAGGAGG - Intronic
956648326 3:71479135-71479157 AAGGATAGGGCTGGGCGTGGTGG + Intronic
961017623 3:123479830-123479852 AAGGCTAGCACTGAGCAAGACGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
965001345 3:162958207-162958229 AAGCCTAGGGCTGGGCGTGGTGG + Intergenic
965676277 3:171200297-171200319 AGGACTAGGCCTGAGCCTGGAGG + Intronic
966835390 3:184045718-184045740 AAGGCTGGGGCTGAGCGTGGTGG + Intergenic
969407604 4:7004345-7004367 AAGACGAGGCCTGTGCCAGGTGG + Intronic
974291770 4:59942061-59942083 AAGGCAAGGCATGAGCGAAGGGG + Intergenic
974637648 4:64585431-64585453 AAGGATAAGCCTGAGGGAGAAGG - Intergenic
975281659 4:72569034-72569056 CAGGCTAAGCCTGGGAGAGGGGG + Intergenic
976631765 4:87245549-87245571 GAGGCTGGGCCTGAGGCAGGTGG + Intergenic
976777695 4:88723851-88723873 TATTCGAGGCCTGAGCGAGGAGG + Intergenic
981066194 4:140488893-140488915 AAGGCTAGGCCAGAGCAGGCAGG - Intronic
982552254 4:156817769-156817791 TAGGCTAGGGCTGGGCGTGGTGG + Intronic
982998658 4:162383447-162383469 AAGTCAAGTCCTGAGGGAGGTGG + Intergenic
990738272 5:58887576-58887598 AAGGTTATGCCTGAGCAGGGCGG - Intergenic
992500751 5:77340560-77340582 AAGGGTAGGACTGGGCAAGGCGG - Intronic
999088073 5:148910969-148910991 AAGGCTGGGCCTGGGTGAGGAGG - Intergenic
1002522326 5:179798663-179798685 AAGGCCAGGCCTGCGCCAGGAGG + Intronic
1002838807 6:888045-888067 AGAGCCAGGCCTGAGCGTGGAGG - Intergenic
1003173370 6:3737403-3737425 AAGGCAAGGCCTCAGCGACCTGG + Intronic
1003507968 6:6755349-6755371 AAAGCTAGGGCTGCGCGCGGTGG - Intergenic
1003676572 6:8210197-8210219 CAGGCTAGGCCAAAGCCAGGAGG + Intergenic
1007173795 6:39882889-39882911 GAGGCTAGGCCAGAGTCAGGGGG - Intronic
1010454546 6:76039645-76039667 AAAGCTAGGCCTTGGCCAGGTGG - Intronic
1011346908 6:86380199-86380221 AGGGCTAGGAATGAGGGAGGTGG + Intergenic
1012526218 6:100181273-100181295 AAGGCTATGCATGTGGGAGGAGG - Intergenic
1012838053 6:104294882-104294904 AAGGCTAGGCCAGATCCAAGGGG + Intergenic
1013610237 6:111787965-111787987 AAGGCAAGGCATGAGGGAGGAGG - Intronic
1015898486 6:138039707-138039729 AAGGCCAGGCCCGGGCGCGGTGG - Intergenic
1017726770 6:157281738-157281760 GCGGCTGGGCCTGAGCCAGGAGG - Intergenic
1018138839 6:160806617-160806639 AAGGCTGTGGCTGAGCAAGGTGG + Intergenic
1018872719 6:167795753-167795775 AGGGCTATGCCAGAGTGAGGTGG - Intronic
1019433901 7:1012105-1012127 GAGGCTGGGCCTGTGCCAGGAGG - Intronic
1022940435 7:35231761-35231783 AAGGGAAGGCCTCAGAGAGGAGG + Intronic
1023882514 7:44328318-44328340 ATGGCTGGGCCTGAGAGAGGAGG - Intronic
1026097239 7:67356197-67356219 AAGGCCAGGGCTGGGCGCGGTGG + Intergenic
1029146869 7:98452592-98452614 AGGGCAAGGCCTGAGGGTGGTGG - Intergenic
1029420610 7:100469932-100469954 GTGACTAGGCCTGAGCGAGCAGG + Intronic
1030354373 7:108526242-108526264 AGGCAGAGGCCTGAGCGAGGCGG - Intronic
1030786128 7:113664166-113664188 AATGCTTGGGCTGAGCAAGGTGG - Intergenic
1031960069 7:127981063-127981085 AATGCTACGTCTGAGCAAGGAGG - Intronic
1035903939 8:3488629-3488651 TATGCTAGGACTCAGCGAGGAGG - Intronic
1047781095 8:128111747-128111769 AAGGCTAGGCCTAGAAGAGGAGG + Intergenic
1048463361 8:134641165-134641187 AAGGCCAGGCCTGAGAGTTGTGG - Intronic
1048835560 8:138515513-138515535 AAGGCTATGCAAGAGGGAGGGGG + Intergenic
1049095890 8:140547855-140547877 AAAGCCTGGCCTGGGCGAGGCGG - Intronic
1049376177 8:142290196-142290218 AAGGCCAGGCCTGAGAAGGGTGG + Intronic
1049559183 8:143299678-143299700 CAGGCTGGGCCTGAGCGCTGTGG + Intergenic
1049949352 9:629272-629294 AAGCCTCAGCCTGAGGGAGGGGG - Intronic
1056490382 9:87100930-87100952 AAGGTTAAGCCTGGGCGTGGTGG - Intergenic
1057518501 9:95741411-95741433 AAGGCTTGGCCTGAATGAGGTGG + Intergenic
1059450725 9:114370201-114370223 GAGGCTGGGCCTGAAAGAGGGGG - Intronic
1060593308 9:124832960-124832982 AAGGCTAGGCCTCAGCCCGTGGG - Intergenic
1060984818 9:127813883-127813905 TAAGCTGGGCCTGAGCCAGGAGG - Exonic
1061313317 9:129778010-129778032 AAGGCTGAGGCTGGGCGAGGTGG + Intergenic
1061371789 9:130201537-130201559 AGGGCTGGGCCTGGGGGAGGAGG + Intronic
1061626074 9:131841502-131841524 CAGGCATGGCCTGGGCGAGGCGG - Intergenic
1062211518 9:135366806-135366828 AGGCCTTGGCCTGAGCGAGATGG - Intergenic
1062381090 9:136286882-136286904 AGGGCCAGGCGTGAGCGAGGGGG + Intronic
1062730465 9:138105558-138105580 GTGCCTAGGCCTGAGTGAGGTGG - Intronic
1190744077 X:53310785-53310807 AAGGCTGGGCCTGAGCTAGGGGG + Intronic
1191857608 X:65639812-65639834 AAGGCTAGGCCTGATCTGGGAGG + Intronic
1197693135 X:129523490-129523512 AAGGGGGGGCCTGAGCGAAGGGG - Exonic
1200092366 X:153642095-153642117 TAGGCTGGGCCTGGGCTAGGTGG - Intergenic
1200647560 Y:5805103-5805125 GAGCCTAGGGCTGGGCGAGGTGG + Intergenic
1200978119 Y:9235327-9235349 CAGGCTGTCCCTGAGCGAGGCGG + Intergenic