ID: 920034663 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:203058195-203058217 |
| Sequence | CTGGCTGAGGAGGAGGAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2446 | |||
| Summary | {0: 1, 1: 5, 2: 41, 3: 337, 4: 2062} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920034656_920034663 | 19 | Left | 920034656 | 1:203058153-203058175 | CCTTTCTGCAGCTCAGGAAGATG | 0: 1 1: 0 2: 2 3: 40 4: 474 |
||
| Right | 920034663 | 1:203058195-203058217 | CTGGCTGAGGAGGAGGAGGAGGG | 0: 1 1: 5 2: 41 3: 337 4: 2062 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920034663 | Original CRISPR | CTGGCTGAGGAGGAGGAGGA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||