ID: 920034663

View in Genome Browser
Species Human (GRCh38)
Location 1:203058195-203058217
Sequence CTGGCTGAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2446
Summary {0: 1, 1: 5, 2: 41, 3: 337, 4: 2062}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920034656_920034663 19 Left 920034656 1:203058153-203058175 CCTTTCTGCAGCTCAGGAAGATG 0: 1
1: 0
2: 2
3: 40
4: 474
Right 920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG 0: 1
1: 5
2: 41
3: 337
4: 2062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920034663 Original CRISPR CTGGCTGAGGAGGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr