ID: 920035697

View in Genome Browser
Species Human (GRCh38)
Location 1:203063955-203063977
Sequence GTGGACCCGCAGGTCCTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920035697_920035709 26 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035709 1:203064004-203064026 GTGAGCGCGGCTGGGACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 198
920035697_920035708 25 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035708 1:203064003-203064025 GGTGAGCGCGGCTGGGACCCAGG 0: 1
1: 0
2: 1
3: 32
4: 300
920035697_920035705 17 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035705 1:203063995-203064017 CTTCCATCGGTGAGCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 30
920035697_920035706 18 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035706 1:203063996-203064018 TTCCATCGGTGAGCGCGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
920035697_920035703 4 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035703 1:203063982-203064004 AGATGGTGGACAGCTTCCATCGG 0: 1
1: 0
2: 2
3: 12
4: 111
920035697_920035700 -10 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035700 1:203063968-203063990 GCGGGTCCACCTGAAGATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 123
920035697_920035704 13 Left 920035697 1:203063955-203063977 CCAAGAAGGACCTGCGGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 920035704 1:203063991-203064013 ACAGCTTCCATCGGTGAGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920035697 Original CRISPR GTGGACCCGCAGGTCCTTCT TGG (reversed) Exonic
900516642 1:3085344-3085366 GTAGTCCCCCAGGTCCTGCTGGG - Intronic
901741574 1:11345347-11345369 GTGGCCCCGCAGGTCCTGTGAGG - Intergenic
901957283 1:12795749-12795771 GTGGCGCAGCAGGTCCTTCAGGG - Exonic
901965302 1:12861532-12861554 GTGGCGCAGCAGGTCCTTCAGGG - Exonic
901973682 1:12928006-12928028 GTGGCGCAGCAGGTCCTTCAGGG - Intronic
901980695 1:13031883-13031905 GTGGCGCAGCAGGTCCTTCAGGG - Exonic
901988739 1:13095399-13095421 GTGGCACAGCAGGTCCTTCAGGG + Intergenic
901993074 1:13131368-13131390 GTGGCACAGCAGGTCCTTCAGGG - Intergenic
902001394 1:13197048-13197070 GTGGCGCAGCAGGTCCTTCAGGG + Exonic
902011496 1:13273761-13273783 GTGGCGCAGCAGGTCCTTCAGGG + Intergenic
907928215 1:58974496-58974518 GTGGGCCCTCAGTACCTTCTAGG - Intergenic
920035697 1:203063955-203063977 GTGGACCCGCAGGTCCTTCTTGG - Exonic
920852762 1:209639841-209639863 CTGGACCTGCAGGTCCTTCTGGG + Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076606843 10:131694865-131694887 GTGGCCACACAGCTCCTTCTGGG - Intergenic
1077418523 11:2437126-2437148 GGGGATCCCCAGGTCCTTCATGG + Intergenic
1077633739 11:3827773-3827795 CTGGGCTCTCAGGTCCTTCTTGG + Exonic
1078147144 11:8729967-8729989 GTGACCACGCATGTCCTTCTTGG + Exonic
1083446452 11:62710791-62710813 GAGGAGCCTCAGTTCCTTCTTGG + Intronic
1084416822 11:69037313-69037335 GGGGACGCTCGGGTCCTTCTTGG + Intergenic
1085471038 11:76758176-76758198 AGGGACCCGCAGGGGCTTCTGGG - Intergenic
1096183291 12:49563044-49563066 GTGGGCCTGCAGGGCCTTCGCGG + Exonic
1096558316 12:52417933-52417955 GTGAGCCCTCAGGTGCTTCTGGG - Intergenic
1103852800 12:123944122-123944144 GAGGAGCCACAGATCCTTCTTGG + Intronic
1112296122 13:98188665-98188687 GGGGACCCGCAGGTCAGCCTGGG - Intronic
1122921823 14:104883470-104883492 GTGGACAGGCAGGTCGCTCTTGG - Exonic
1123050100 14:105537273-105537295 GTGGGCCCGCAGGTGCTGCAGGG - Intergenic
1125776097 15:42215418-42215440 GTGAACCCGGAGGTTCTTATGGG + Intronic
1129718732 15:77866319-77866341 GTGGAGCCTCAGGGCCCTCTCGG + Intergenic
1132640321 16:975191-975213 ATGGAGCCGCATCTCCTTCTGGG - Intronic
1138459300 16:57138576-57138598 GTTCCCCCGCAGGTCCTTCCTGG + Intronic
1138646487 16:58429254-58429276 GTGGACAGGCAGGTCGTTCTGGG - Intergenic
1141495820 16:84408697-84408719 CTGGACACACAGGTGCTTCTGGG + Intronic
1151387070 17:73761423-73761445 CTGGACCCTCAGGGCCTCCTGGG - Intergenic
1152521180 17:80857933-80857955 GTGAACCTGCCGGCCCTTCTGGG + Intronic
1153731711 18:8020307-8020329 GTGGACTCGCAGGTCAGTATGGG + Intronic
1155239748 18:23854024-23854046 GTGGCCCCGCTGGGCCTGCTAGG - Intronic
1160500567 18:79399661-79399683 GGAAACCCGCCGGTCCTTCTAGG - Intronic
1160801913 19:974235-974257 GGGGACCCCCACTTCCTTCTCGG + Exonic
1161077031 19:2290830-2290852 GTGGAGCCGCAGGCCTTCCTGGG - Exonic
1161407087 19:4096612-4096634 CGGGACCTACAGGTCCTTCTAGG + Intronic
1161646442 19:5456144-5456166 GATGACCCGCAGGTCCTGCGAGG - Exonic
1161801045 19:6416859-6416881 GTGGTCCCCCAGGTCCTCCAGGG - Exonic
927629105 2:24755625-24755647 GTGGACCCAGACGTCTTTCTAGG + Intronic
933042548 2:77487532-77487554 GTGGGCCTGCAGGTGCTCCTCGG + Intronic
936463543 2:112728020-112728042 GGGGACCAGTGGGTCCTTCTAGG - Intronic
936802676 2:116286567-116286589 GTGGTCCTGCAGGTTCTTCAGGG - Intergenic
1173641923 20:44609458-44609480 GAGGAGCCGCAGTTCCTTCTTGG - Intronic
1173812308 20:45963557-45963579 GTGGAAGCGCAGGTCCTCGTGGG + Exonic
1175790759 20:61738565-61738587 ATGGCCCCTCAGGTCCTGCTGGG - Intronic
1176289412 21:5036261-5036283 GTGCCCCCGCAGGTCCGTCCTGG - Intronic
1179041819 21:37809859-37809881 GTGGATCCCCAGGTCACTCTGGG - Intronic
1179168700 21:38956085-38956107 GTGGACCAGGAGGTCCTGATGGG - Intergenic
1179867819 21:44227326-44227348 GTGCCCCCGCAGGTCCGTCCTGG + Intronic
1181895531 22:26104375-26104397 GTGGACTCTCAGGTCCTTAATGG + Intergenic
1183332979 22:37231313-37231335 GTCGTCCCGCAGGTCCAGCTTGG + Exonic
953922474 3:46961669-46961691 GTGGACAGGCAGTTCCTTGTAGG - Intronic
956686271 3:71831051-71831073 GTGGTCCCGGAGGCCCTTTTGGG + Intergenic
968889963 4:3363677-3363699 GTGGACCTGCCGGCCCTCCTGGG + Intronic
976214737 4:82705336-82705358 GTGGAGCCACAGGTCCTACCGGG - Exonic
983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG + Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
988239556 5:28591865-28591887 CTTGAGCCGCAGGTCTTTCTTGG - Intergenic
992842771 5:80712200-80712222 GAGGACCAGCATCTCCTTCTGGG + Intronic
997585440 5:135040507-135040529 GTGGCCCCGCAGGCCGTTCCTGG + Intronic
999282021 5:150372260-150372282 GGGGACCCGCAGGTCCTCCAAGG - Intronic
1000551105 5:162665712-162665734 GTGGACCTGCAGGTCCCACTGGG + Intergenic
1005993360 6:30917083-30917105 GTGGACACTCAGGTCATTCCAGG + Exonic
1006005881 6:31001104-31001126 GTGGACACGAAGGTTCTTCAAGG - Intergenic
1006737353 6:36283926-36283948 GTGGACCCAGAAGTCCTTTTGGG - Intronic
1007200344 6:40102770-40102792 GTGAACACACAGGGCCTTCTAGG + Intergenic
1014505371 6:122248177-122248199 GTGGACCCACAGGTGCCCCTTGG - Intergenic
1018390444 6:163337168-163337190 GTGGACCCTCAGCTCTTCCTCGG - Intergenic
1019699753 7:2468921-2468943 GTGGACCCGCATTTCCAGCTCGG - Intergenic
1020324407 7:6963109-6963131 CTGGCCCAGCAGGTCCTTCCGGG - Intergenic
1020369851 7:7419915-7419937 GAGGCCCTCCAGGTCCTTCTGGG - Exonic
1020888047 7:13844393-13844415 GTGGTCCTGGAGATCCTTCTAGG - Intergenic
1023579147 7:41662994-41663016 GTGAAACCGCAGCTCATTCTTGG - Intergenic
1026941895 7:74291857-74291879 GTGGTCCCCCAGTTCCCTCTTGG + Intronic
1036371660 8:8167843-8167865 CTGGCCCAGCAGGTCCTTCCGGG + Intergenic
1036879243 8:12497801-12497823 CTGGCCCAGCAGGTCCTTCCGGG - Intergenic
1049688996 8:143950605-143950627 GCGGGGCCGCCGGTCCTTCTTGG + Exonic
1053306099 9:36985938-36985960 TTGGACAGGCAGGTCCTCCTGGG - Intronic
1053391815 9:37741305-37741327 GTGGCCCTGCAAGGCCTTCTGGG + Intronic
1057604753 9:96491097-96491119 CTGGACCTGCAGGCCCTCCTAGG - Exonic
1061861887 9:133472513-133472535 GTGGGCACGCAGGTTCTTCTTGG + Intronic
1062689599 9:137834452-137834474 GGGGAACCGCAGGTCCTGGTGGG - Exonic
1188108007 X:26165698-26165720 GAGGAGCTGCAGGTCCTTCTAGG + Intergenic
1188111401 X:26198955-26198977 GAGGAGCTGCAAGTCCTTCTAGG + Intergenic
1192679961 X:73242060-73242082 GTGGACCCCAAGATCCTGCTTGG - Intergenic
1195751541 X:108165001-108165023 CTGGACCCCCAGGTCCCCCTGGG - Exonic
1198824501 X:140685162-140685184 GTGGCCACACAGGTCCCTCTTGG + Intergenic