ID: 920035909

View in Genome Browser
Species Human (GRCh38)
Location 1:203065316-203065338
Sequence GCCCCCACCCAAATCAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920035897_920035909 30 Left 920035897 1:203065263-203065285 CCCAGCATGAGGGCTGACTTGTG 0: 1
1: 0
2: 0
3: 16
4: 165
Right 920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 127
920035901_920035909 -1 Left 920035901 1:203065294-203065316 CCGCATCCTCCCCTCTGCACCCG 0: 1
1: 0
2: 4
3: 61
4: 646
Right 920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 127
920035898_920035909 29 Left 920035898 1:203065264-203065286 CCAGCATGAGGGCTGACTTGTGA 0: 1
1: 0
2: 1
3: 8
4: 107
Right 920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 127
920035902_920035909 -7 Left 920035902 1:203065300-203065322 CCTCCCCTCTGCACCCGCCCCCA 0: 1
1: 0
2: 3
3: 148
4: 1485
Right 920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 127
920035903_920035909 -10 Left 920035903 1:203065303-203065325 CCCCTCTGCACCCGCCCCCACCC No data
Right 920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920035909 Original CRISPR GCCCCCACCCAAATCAGCTA GGG Intronic
900092574 1:926813-926835 GCCCCCACCCCCAGCAGCCATGG - Intronic
902410647 1:16209878-16209900 GCCACCACCCAGATCAGGCAGGG + Intronic
905335134 1:37239832-37239854 TCCCCTACCCAGATCAGCTATGG + Intergenic
905894864 1:41538975-41538997 TCCCCCACCCACAGCAGCTCTGG + Intronic
907305858 1:53512881-53512903 GCCCCCACCCATAGCTGCTCAGG - Intronic
911246363 1:95522880-95522902 GTCCCCACCCAAATCACATCTGG + Intergenic
912486805 1:110035184-110035206 GCCCCCAACCTAATCATCTCGGG + Intronic
914323910 1:146592472-146592494 GCCCCTACCCAAACCAGGGATGG + Intergenic
920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG + Intronic
924166083 1:241284764-241284786 ACTCCCACCCATATCAGCAAAGG - Intronic
1064206371 10:13327451-13327473 CCCTCCACCCAAAACAGCTCCGG - Intronic
1064863531 10:19853636-19853658 CCCCCCACCCAAAGCAGCATTGG - Intronic
1070761808 10:79028623-79028645 GCCCACACCCCAAACAGCAAGGG - Intergenic
1075464296 10:122639961-122639983 ATTCACACCCAAATCAGCTATGG + Intronic
1076776227 10:132699613-132699635 GCCCCCACCCCCAAGAGCTATGG - Intronic
1077219819 11:1410937-1410959 GCCCCCACCCCAGCCAGCAAGGG - Intronic
1077489145 11:2852560-2852582 GTCCCCACCCAGGTCAGCCAGGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080000229 11:27338943-27338965 GCCACCTCCCAAAGAAGCTAAGG - Exonic
1080669350 11:34361976-34361998 GCCCCCACCCACATCAGAAAGGG + Intergenic
1087403221 11:97694945-97694967 GTCCCCACCCAAATCTCATATGG + Intergenic
1088363824 11:109018302-109018324 TCTTCCACCTAAATCAGCTAAGG + Intergenic
1090271687 11:125390358-125390380 GACCACACCCAAAGCAGCTCTGG + Intronic
1094497337 12:30996522-30996544 GCTTCCACCTAGATCAGCTAAGG - Exonic
1097347477 12:58510213-58510235 GGCCCCACCCACATCAGGCAGGG - Intergenic
1098018406 12:66130537-66130559 GCCCCCACCAAAAAGAGCAAGGG + Intronic
1100165293 12:91910735-91910757 GCCCCCAGCATAATTAGCTATGG + Intergenic
1101559901 12:105846941-105846963 GTCACCACCCAAATAAGGTAAGG - Intergenic
1103736938 12:123066503-123066525 GCCCCCACCCCCAACAGCTGTGG - Intronic
1104297629 12:127531772-127531794 GTCCCCTCCCCAATCAGCAAAGG - Intergenic
1107938246 13:45363028-45363050 GTCTCCACCCCAATCAGCAAAGG + Intergenic
1112611750 13:100962099-100962121 GCCCCAACCCCAACCAGCTCAGG - Intergenic
1112744787 13:102514488-102514510 GCCCCCACCCACATTAGAGAGGG - Intergenic
1116287324 14:42989157-42989179 GTCCCCACCCAAATCTCATAAGG - Intergenic
1119770228 14:77216006-77216028 GCGCCCAGCCAAATTAGCCATGG - Intronic
1120654314 14:87170459-87170481 GTCCCCACCCAAATCTCCTCTGG - Intergenic
1121095379 14:91214785-91214807 GCCTCCACCCCAATGAGCTATGG + Intronic
1125796748 15:42409077-42409099 GCCCCCAGCCAAAGGAGATATGG - Intronic
1125969107 15:43897758-43897780 GTCCCCACCCAAATCTGATGTGG + Intronic
1131451486 15:92543966-92543988 CCCACCACCCAAATGAGCTTGGG + Intergenic
1139133978 16:64179097-64179119 GCCCCCACCCAAATCTCTTCTGG + Intergenic
1140009652 16:71118372-71118394 GCCCCTACCCAAACCAGGGATGG - Intronic
1142592140 17:1010941-1010963 GCCCCCACCCACTCCAGCTCTGG + Intronic
1144505719 17:15828920-15828942 GCCCCACCGCACATCAGCTATGG - Intergenic
1144802547 17:17940467-17940489 GCCCCCACCCAGCTCAGGGATGG + Intronic
1145169894 17:20646852-20646874 GCCCCACCGCACATCAGCTATGG - Intergenic
1146942318 17:36851854-36851876 GCTCCCACCCAAATAATCCAAGG + Intergenic
1148894949 17:50834175-50834197 GCCCCCACACGCATCAGATACGG - Intergenic
1151556053 17:74847276-74847298 CCCCCCACCCCCAGCAGCTATGG + Intronic
1155074677 18:22343999-22344021 GTCTCCACTCAAATCAGCTGTGG + Intergenic
1159931309 18:74315615-74315637 GGCCCCACCCACACCAGCTCAGG + Intergenic
1159951656 18:74488531-74488553 GCCCCCACCCAAATCTCATCCGG + Intergenic
1165878042 19:39023550-39023572 GCACTCACCAAAATCAGCCAGGG + Intronic
1166978072 19:46616767-46616789 TCCCCCACCAAACTGAGCTACGG + Intergenic
933008408 2:77024216-77024238 GCCCCCACCCAAATCTCATTTGG - Intronic
933621554 2:84548740-84548762 GCCACCAACCAAAGCAGCTCTGG + Intronic
935551284 2:104459041-104459063 GCAACTACCAAAATCAGCTAAGG - Intergenic
935887187 2:107634938-107634960 GCCCCCACCCAAATCTCATCGGG - Intergenic
941397731 2:164993739-164993761 GCCCCCACGTAAATCAGACAGGG - Intergenic
942825587 2:180170867-180170889 GTCCCCACCCAAATCTCCTCTGG - Intergenic
946995399 2:225384977-225384999 GTCCCCACCCAAATCTCATATGG + Intergenic
947833508 2:233158885-233158907 CCCCCCACCCACCTCAGCTGAGG + Intronic
948371219 2:237490163-237490185 GCCCCCACCCCACCCAGCTAGGG + Intronic
948783287 2:240337916-240337938 GTCCCCACCCAAATCTCCTCTGG - Intergenic
1169761753 20:9102728-9102750 GCCCCCCCCCAAATATGCTCTGG - Intronic
1170288806 20:14744605-14744627 GGCCCCTCCCACATCAGCTCTGG + Intronic
1173450257 20:43157504-43157526 CCTCCCACCATAATCAGCTATGG - Intronic
1174444361 20:50580476-50580498 GCCCCCACCAAAATATGCTTTGG - Intronic
1180289308 22:10782694-10782716 GCCCCCACCCCAATAAAGTATGG + Intergenic
1181035938 22:20169778-20169800 GCCCCCACCCCCACCAGCCAGGG + Intergenic
1183286890 22:36972111-36972133 GCCTCCTCCCAGATCAGCTTTGG + Intergenic
949946639 3:9194864-9194886 GCCACCACCCAAAGCAGCCAAGG - Intronic
950554313 3:13686034-13686056 GCCCCCTCCCAGATGAGCTGCGG - Intergenic
954716946 3:52531657-52531679 CCCCCCACCCACACCACCTATGG - Intronic
956370101 3:68549830-68549852 AGCCCCACCCAAAACATCTAGGG - Intergenic
957686021 3:83503856-83503878 GCCCCAACCCAAACCATCTGTGG + Intergenic
958823468 3:99002612-99002634 GCCCTCACCCACCTCTGCTAGGG - Intergenic
958935347 3:100250366-100250388 GCCCCCACCCAAATCTCATGTGG - Intergenic
960155298 3:114292463-114292485 GCTCCCACCCAGCTCAACTATGG + Intronic
960825505 3:121779175-121779197 GCCCATACCCAAACCAGTTAAGG - Intronic
964218712 3:154319894-154319916 TCCCCTACCCCTATCAGCTACGG + Intronic
969525413 4:7701671-7701693 GCCCCCACCCAGGTCTGCTGGGG + Intronic
970525485 4:16927811-16927833 TCCCCCACCCAAATCCTCCATGG + Intergenic
971890033 4:32507958-32507980 GTCCCCACCCAAATCAGGGGAGG + Intergenic
972373870 4:38451881-38451903 GTCCCCACCCAAATCTCATATGG - Intergenic
977067587 4:92337755-92337777 GTCCCCACCCAAATCTCCTTGGG - Intronic
983593636 4:169441752-169441774 GCACCCACACACATCATCTAGGG + Intronic
986787035 5:11123920-11123942 GCCCCCACACACACCAGTTATGG + Intronic
987714913 5:21555695-21555717 GCTCCCACCAAAAGAAGCTAGGG - Intergenic
988297997 5:29390850-29390872 GCCCCCACCTCCATCCGCTATGG + Intergenic
988699907 5:33663019-33663041 GCCCACACCCAAATCATAAAAGG + Intronic
989103360 5:37839779-37839801 CCCCCCACCCAAAGCAGCGGCGG - Intergenic
989821881 5:45802112-45802134 GCCCCCACCCAAATCTCATCTGG + Intergenic
993137552 5:83989314-83989336 GCCCCCACCCCCATGAGCTAAGG + Intronic
996915523 5:128707574-128707596 GTCCCCACCCAAATCTCATATGG - Intronic
998273883 5:140733295-140733317 GGCCCCACCCACTTCAGCAAAGG + Intergenic
1000947321 5:167437612-167437634 GTCCCCACCCAAATCTCATATGG + Intronic
1001189080 5:169609968-169609990 GACACCAGCCAAAGCAGCTAAGG + Intergenic
1001325557 5:170721213-170721235 GCCCCTACCCAGATCAGGTGGGG + Intronic
1003089374 6:3088635-3088657 AACCCCACCCACAGCAGCTAAGG - Intronic
1006584009 6:35093835-35093857 GGCCCCACCCAGATCAGCAAAGG + Intergenic
1009001810 6:57726334-57726356 GCTCCCACCAAAAGAAGCTAGGG + Intergenic
1011434417 6:87322002-87322024 GTCCCCACCCAAATCTCATATGG - Intronic
1015264652 6:131278808-131278830 GTCCCCACCCAAATCTCCTGCGG - Intronic
1015283175 6:131456187-131456209 GCTCTCACCCAAATCATTTAAGG + Intergenic
1019178456 6:170172951-170172973 TGCCTCCCCCAAATCAGCTACGG - Intergenic
1019548919 7:1592630-1592652 GCCCCCACCCACATCCGCTCAGG + Intergenic
1021782819 7:24122587-24122609 GCCCCCACCTTACTCAGCTCAGG + Intergenic
1022523983 7:31025670-31025692 GCCCCCACCCAATTGAGGCAGGG - Intergenic
1023233927 7:38064438-38064460 GCCTCCACCAGAATCACCTAAGG + Intergenic
1031703656 7:124957101-124957123 GTCCCCACCCAAATATGATATGG + Intergenic
1033756096 7:144399121-144399143 GCCCCCACCCAACCCAGTGAGGG - Exonic
1034615772 7:152415523-152415545 GCCCCCACCCCAATAAACCATGG + Intronic
1037662490 8:20939741-20939763 GGCCACAACCAAATCAGCTGGGG + Intergenic
1037911005 8:22743525-22743547 GCCCCCACTCCAAACAGCTGTGG - Intronic
1039101430 8:33946024-33946046 GTCCCCACCCAAATCTCATATGG - Intergenic
1039575827 8:38623312-38623334 GCCACCAACCAAATCAAATAGGG + Intergenic
1039888786 8:41670793-41670815 GCCCCCACCCCAAGGAGCTCAGG - Intronic
1041312042 8:56526760-56526782 GTCCCCACCCAAATCAAGGAAGG - Intergenic
1043597505 8:81902364-81902386 GACCTCTCCCAAATCAGTTAGGG - Intergenic
1045694408 8:104792539-104792561 GTCCCCACCCAAATCTCATATGG + Intronic
1047019434 8:120759068-120759090 GCCCCAACCCACTTTAGCTAAGG + Intronic
1047200533 8:122761468-122761490 GCCCCCACCCAAGCCAACAAAGG + Intergenic
1048916128 8:139184873-139184895 GTCCCCACCCAAATCTCATATGG + Intergenic
1049589761 8:143452126-143452148 ACCCCCAGCCAGATCAGCAAAGG + Intronic
1051403674 9:16710744-16710766 TCCCCCTCCCAACTCACCTAAGG + Intronic
1052466017 9:28830306-28830328 GCCCCCACCCCACTCATCCAGGG - Intergenic
1058141204 9:101358178-101358200 GTCCCCACCCAAATCTGCAGAGG - Intergenic
1058588476 9:106535356-106535378 ACCCCCACCAAAATAAGCAAAGG + Intergenic
1059138475 9:111830080-111830102 CCCACCAACCAAATCAGGTATGG - Intergenic
1061284499 9:129614355-129614377 GATCCCTCCCAAATCAGCGAAGG + Intronic
1061689073 9:132309812-132309834 GCCCCCACCCCCATCACCCATGG - Intronic
1062206626 9:135341227-135341249 GCACCCACCCAACTGAGCTGCGG + Intergenic
1192454537 X:71266060-71266082 GACCTCTCCCAAATCAGTTAGGG + Intergenic
1195179174 X:102339907-102339929 GCCCCCACCCCACACAGCTGTGG - Intergenic
1199343905 X:146715568-146715590 GTCCCCACCCAAATCTCATATGG - Intergenic