ID: 920037965

View in Genome Browser
Species Human (GRCh38)
Location 1:203077682-203077704
Sequence TTGGGTTCCCATCATGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920037965_920037968 -8 Left 920037965 1:203077682-203077704 CCAGCAGCATGATGGGAACCCAA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 920037968 1:203077697-203077719 GAACCCAAGCTGAGGGATACAGG 0: 1
1: 0
2: 3
3: 12
4: 137
920037965_920037971 3 Left 920037965 1:203077682-203077704 CCAGCAGCATGATGGGAACCCAA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 920037971 1:203077708-203077730 GAGGGATACAGGTCCTGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 80
920037965_920037972 7 Left 920037965 1:203077682-203077704 CCAGCAGCATGATGGGAACCCAA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 920037972 1:203077712-203077734 GATACAGGTCCTGATTTGGTAGG 0: 1
1: 0
2: 1
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920037965 Original CRISPR TTGGGTTCCCATCATGCTGC TGG (reversed) Exonic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
904813386 1:33178712-33178734 TTGGGTTCCAAACCTGCTGTGGG - Intronic
911477356 1:98389963-98389985 TCTGGTTCCCATCAGGCTCCTGG - Intergenic
916092038 1:161314890-161314912 CTGGGTTCCCAGCGGGCTGCTGG + Intronic
918409195 1:184241058-184241080 TAGGGTTCCCACCATTCAGCTGG - Intergenic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
921103056 1:211948036-211948058 TTGGGTTTCAATCAGGCTGGTGG - Intronic
922062288 1:222104177-222104199 TTGGGGTCCCAGCATCCTGCAGG + Intergenic
923064370 1:230504477-230504499 TTGTGTCCTCAGCATGCTGCTGG + Intergenic
923607544 1:235458158-235458180 TTGGCTTCCCAAAGTGCTGCCGG + Intronic
924294721 1:242574662-242574684 GTGGGTTCACTTCATGATGCAGG - Intergenic
1066076954 10:31888306-31888328 GTGGGGTCCAATCATGCTCCTGG + Intronic
1069548857 10:69348452-69348474 TGGAGTTCCCATCATGCAGCTGG + Intronic
1074340311 10:112622045-112622067 TCTGGTTCTAATCATGCTGCAGG + Intronic
1074964643 10:118479544-118479566 TTGGGCTCCCCTCATGATGGAGG + Intergenic
1075594974 10:123722598-123722620 TTTGATTTCGATCATGCTGCTGG - Intronic
1078519410 11:12051228-12051250 CTGGGTTCCCACCATGATGTGGG - Intergenic
1080892000 11:36417148-36417170 TTGGGTACTCATGATGCTGAGGG - Intronic
1081399114 11:42622219-42622241 TTGGGTTCCTATCATTCTCCAGG + Intergenic
1088305681 11:108404860-108404882 TTGGGATTCGATCAGGCTGCTGG + Intronic
1100880425 12:99010014-99010036 TTGGGTTCCCTCCACGCTCCTGG - Intronic
1101694992 12:107116663-107116685 GTGGTTTCTCATCATGCAGCAGG - Intergenic
1101779635 12:107823897-107823919 TTATGTTCCCATCAAGCTGTAGG + Intergenic
1104055302 12:125225517-125225539 TTGGATTTCCATCATGTTTCTGG + Intronic
1105844028 13:24279505-24279527 CTGGGTTCCCATCCAGCTTCGGG - Intronic
1110619934 13:77584231-77584253 TTGGCATCACATCATGCTCCTGG + Intronic
1111409350 13:87854093-87854115 TTTGACTCCCATCATGCTCCAGG + Intergenic
1114406940 14:22465698-22465720 TTGTCTTCCCATCAAGCTGGAGG - Intergenic
1114766096 14:25372294-25372316 TTGGGCTTCCTTCATGCTGCTGG - Intergenic
1117925204 14:60771830-60771852 TTAGGTGCCCATCATGTAGCAGG - Intronic
1118736645 14:68705883-68705905 CTGAGTACCCATCATCCTGCCGG + Intronic
1121419983 14:93806439-93806461 TTGGCTTCCCTGCCTGCTGCAGG - Intergenic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1122452690 14:101823476-101823498 TTGGGTATCTATCATGCTGTGGG - Intronic
1125365939 15:38916222-38916244 GTGGGCTCACATCATGCTTCTGG + Intergenic
1128235894 15:66066810-66066832 TTGTGTTTCCATTTTGCTGCAGG + Intronic
1130989328 15:88866458-88866480 TTGGATTCCCAGCATGCCCCAGG - Intronic
1133415538 16:5604313-5604335 TTAGGTTCTCACCAAGCTGCAGG + Intergenic
1134317125 16:13128779-13128801 TTTGGTTCTCCTCATGCTGTTGG + Intronic
1135931643 16:26743124-26743146 TTGGGCTCCCACCATGAAGCTGG - Intergenic
1140846625 16:78894992-78895014 TGGAGATCCCATCATGCCGCCGG + Intronic
1141674866 16:85512462-85512484 TGGGGTTCCCATCAGGCAGACGG - Intergenic
1141833656 16:86523944-86523966 CAGGGTTCCCTCCATGCTGCAGG - Intergenic
1143736436 17:8914855-8914877 ATAGGTTTCCCTCATGCTGCTGG - Intronic
1151499722 17:74481141-74481163 TTGAGTTCCTACCATGCTTCAGG + Intronic
1151798638 17:76364002-76364024 TTGGCCTCCCAAAATGCTGCAGG + Intronic
1156458592 18:37308499-37308521 TTGGATGCTCAGCATGCTGCCGG + Intronic
1156867048 18:41900409-41900431 CTGGGTGCCCATCATGCTCCAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163444983 19:17340878-17340900 TTGGGCCCCCAACATTCTGCCGG + Intronic
1166811362 19:45516392-45516414 ATGGGTCCCCAACCTGCTGCAGG + Intronic
1167649384 19:50721143-50721165 CTGGGTTCCCCTCCAGCTGCAGG + Intergenic
1167792595 19:51690858-51690880 CTGGGTTCCCAGCATGCCCCGGG - Intergenic
1168200657 19:54813103-54813125 TTGGATTCCCATCTTCCTCCAGG + Intronic
1168207894 19:54865783-54865805 TTGGATTCCCATCTTCCTCCAGG + Exonic
927456349 2:23252751-23252773 TTAGGTTCCTATCATGCAGTGGG - Intergenic
932922457 2:75932348-75932370 TTGAGTTCCCATTATGTTTCCGG - Intergenic
933449666 2:82431364-82431386 TTTTGTTGCCATCATGCTGTTGG - Intergenic
934296505 2:91746959-91746981 GTGGGTCCCCCTCATCCTGCTGG - Intergenic
937257672 2:120566455-120566477 TGGGCTACCCATCAAGCTGCGGG + Intergenic
940129779 2:150368426-150368448 ATGGGATTCCATGATGCTGCAGG - Intergenic
942116074 2:172730588-172730610 TTGGGTTTCCATCTTGCAGATGG + Intergenic
945798821 2:214398783-214398805 TTTGTTTCCCCTCAGGCTGCAGG + Intronic
946016050 2:216604870-216604892 TTGGCTTCTCATAATCCTGCAGG - Intergenic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
1169972301 20:11281357-11281379 TTGGGTTCCCATCTTCTTACGGG + Intergenic
1169984328 20:11425887-11425909 TTGTGATTCCACCATGCTGCTGG + Intergenic
1171020017 20:21576485-21576507 TTGGGTTTGCATCCAGCTGCTGG + Intergenic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1172847440 20:37938330-37938352 TTGGGTTCTGAACATGCTGAGGG + Intronic
1176590055 21:8639698-8639720 TGGTGTTCCCAGCATGCAGCTGG + Intergenic
1176622997 21:9071298-9071320 CTGGGTACCCTCCATGCTGCAGG + Intergenic
1181689575 22:24551111-24551133 TAGGGTTCACATCACCCTGCAGG - Intronic
1184654795 22:45935604-45935626 CTGGGTGCCCCTCAGGCTGCAGG + Intronic
949137227 3:581989-582011 TGGTGTTCCCAGCATGCAGCTGG - Intergenic
949868607 3:8568000-8568022 TTGGGATCCCAGCCTGCTCCTGG - Exonic
950253171 3:11483872-11483894 TTGTGTTCCCAGCATTCTGAGGG + Intronic
955369181 3:58336291-58336313 TTGTGTTCCCTTCATCCTTCTGG - Intronic
962422513 3:135240874-135240896 GTGGGTTCCAATGTTGCTGCAGG - Intronic
963301768 3:143605393-143605415 TGGGGTTCCCATCATTCTCCTGG - Intronic
966056510 3:175698872-175698894 TTGGATTTCTATCATGCTGTAGG - Intronic
969433197 4:7168075-7168097 TTGGCTTCCCAGAATGTTGCAGG + Intergenic
970093457 4:12435206-12435228 TTGGATTCCCTTCATTCTGGAGG + Intergenic
971322756 4:25618542-25618564 TTGGCCTCCCAACGTGCTGCTGG - Intergenic
974936737 4:68417902-68417924 TTGGGTACCCCTCCTGCTCCTGG + Intergenic
985858500 5:2449853-2449875 TTGGGTTCCCGAATTGCTGCAGG - Intergenic
985957022 5:3273263-3273285 TTGGGTTCACATCATGAGGCAGG + Intergenic
986988507 5:13525365-13525387 TTGGGGTTCCATCAGGCTGGTGG - Intergenic
987338094 5:16914854-16914876 TTGGGATCCCATCTGGCTGTGGG + Intronic
989178307 5:38551705-38551727 TTGGCTTCCAATCATTCTTCTGG - Intronic
995040446 5:107581809-107581831 TTGGGTTCTCATGAGGCTTCAGG - Intronic
1001123030 5:168995777-168995799 TTGGGGTCCCAGCTTGGTGCTGG - Intronic
1002308421 5:178297922-178297944 TTGGATGCCCAGCTTGCTGCAGG - Intronic
1005719738 6:28589699-28589721 TTGGGTTTCCACGTTGCTGCTGG - Intronic
1006285398 6:33089500-33089522 TTAGGTTCCCTTCATTCTGCTGG - Intergenic
1010092236 6:71996767-71996789 TTGGAGATCCATCATGCTGCTGG + Intronic
1018169947 6:161136761-161136783 TTGAGGTGCCATCATCCTGCCGG + Intronic
1018357512 6:163034099-163034121 TTGCCTTCCCACCCTGCTGCAGG - Intronic
1018632538 6:165833607-165833629 TTGGGCCCCCCTCATGCTGAAGG - Intronic
1019830495 7:3323280-3323302 TTGGGTTCCCATCAGACATCAGG - Intronic
1020098275 7:5380444-5380466 GTGGGTTCCCACCTTCCTGCAGG - Intronic
1025712757 7:63927366-63927388 TGGGAGTCCCTTCATGCTGCTGG + Intergenic
1029546595 7:101213353-101213375 TTGGGTTCTGACCAGGCTGCTGG + Intronic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1036733876 8:11290063-11290085 TTGCCTTCCCATGATGGTGCAGG + Intronic
1037710146 8:21348794-21348816 TGGGGTGACCATCATGCAGCAGG + Intergenic
1042359546 8:67867332-67867354 TTGGGATGCCATCAGGCTGAGGG + Intergenic
1046531331 8:115449817-115449839 CTGGGTTCCCATCAGACTGCTGG + Intronic
1046585128 8:116141378-116141400 TTGTTTTCTCATCATTCTGCAGG - Intergenic
1056985645 9:91361834-91361856 TTGGGATCCCTGCATGCTGGCGG - Exonic
1057385776 9:94604904-94604926 TGGTGTTCCCAGCAGGCTGCAGG - Intronic
1194214030 X:91106531-91106553 TACGGTTTCAATCATGCTGCTGG + Intergenic
1194918983 X:99741041-99741063 TTGAGTTCCCATCATGTGGTAGG - Intergenic