ID: 920038641

View in Genome Browser
Species Human (GRCh38)
Location 1:203082039-203082061
Sequence AGTTTCTGAAGAAACTCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920038633_920038641 14 Left 920038633 1:203082002-203082024 CCTCCAGAGGCTTCTTCTGATTC 0: 1
1: 4
2: 1
3: 27
4: 221
Right 920038641 1:203082039-203082061 AGTTTCTGAAGAAACTCGGGGGG 0: 1
1: 0
2: 1
3: 4
4: 114
920038631_920038641 29 Left 920038631 1:203081987-203082009 CCTGAGTTCTGGGAGCCTCCAGA 0: 1
1: 0
2: 1
3: 22
4: 302
Right 920038641 1:203082039-203082061 AGTTTCTGAAGAAACTCGGGGGG 0: 1
1: 0
2: 1
3: 4
4: 114
920038634_920038641 11 Left 920038634 1:203082005-203082027 CCAGAGGCTTCTTCTGATTCTTT 0: 1
1: 0
2: 7
3: 25
4: 346
Right 920038641 1:203082039-203082061 AGTTTCTGAAGAAACTCGGGGGG 0: 1
1: 0
2: 1
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920038641 Original CRISPR AGTTTCTGAAGAAACTCGGG GGG Intergenic
900921607 1:5675203-5675225 AGTTCCTGAAGAAGGTGGGGAGG - Intergenic
901131915 1:6967284-6967306 ATTTTCTGAAAAAATTCAGGTGG - Intronic
901347924 1:8563750-8563772 AATTTCTGGAGAAACTTGGTTGG - Intronic
905244885 1:36605892-36605914 AGTTTCTGTAGCAACTCGGGTGG + Intergenic
906793138 1:48676132-48676154 AGTTTCTGATGAAACCATGGCGG - Intronic
906986532 1:50688946-50688968 ACTTTATGAAGTAACTAGGGTGG + Intronic
910697529 1:90036347-90036369 AGTTTCTGAATAAACTTAAGTGG - Intergenic
912452599 1:109776575-109776597 AGTTTCAGATGAGACTAGGGTGG + Intergenic
916887741 1:169086555-169086577 AGTTTCTGAAGGACCTTTGGAGG - Intergenic
920038641 1:203082039-203082061 AGTTTCTGAAGAAACTCGGGGGG + Intergenic
923120001 1:230980928-230980950 AGTTTCTAATGAAATGCGGGTGG - Intronic
1063531859 10:6840671-6840693 TGTATTTGAAGAAACTGGGGAGG - Intergenic
1064869976 10:19926552-19926574 ACTTTCTCAAGAATCTCAGGTGG + Intronic
1068392302 10:56414168-56414190 GGTTTCTTAAGAAACACAGGAGG - Intergenic
1069766976 10:70869600-70869622 AGTTTCTGCAGAAAATCAGTTGG + Intronic
1070163980 10:73884107-73884129 GGCTACTGCAGAAACTCGGGAGG - Intergenic
1080416227 11:32072405-32072427 AGTTCCTGAAGACACTGGGAAGG + Intronic
1080928578 11:36784140-36784162 TGTTTCTGAGGATACTTGGGAGG + Intergenic
1081160834 11:39745893-39745915 ATTTTCTGAAGAAACTAGAAAGG + Intergenic
1095360599 12:41333853-41333875 AGTTCCTGAAGAATCTCTGTTGG + Intronic
1096861727 12:54533686-54533708 AGTTCCAGGAGGAACTCGGGGGG - Intronic
1097575802 12:61390863-61390885 AGTGTCTGAAAAAACCCAGGCGG - Intergenic
1100727918 12:97429042-97429064 ACATTCTGAGAAAACTCGGGTGG - Intergenic
1101799690 12:108010039-108010061 GGTGTCTGAAGAAACTCGCTAGG + Intergenic
1102387532 12:112522320-112522342 AGTTTATGGTGAAGCTCGGGTGG + Intergenic
1103469585 12:121169403-121169425 ATTATCTGAAGTAACTTGGGTGG + Intronic
1110283550 13:73723418-73723440 ATTTTCTGAAGAAATTCTGTGGG - Intronic
1114277613 14:21161585-21161607 AGTTTCTTAAGAAAGCCTGGAGG + Intergenic
1116065081 14:39972082-39972104 AGTTTATGAAGAAAGTCAAGTGG - Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1120342094 14:83234480-83234502 AGTTTCTGAAAGAACCCTGGAGG - Intergenic
1124098069 15:26667756-26667778 AGTTTCTGAATAAACTGGTCTGG - Intronic
1126102551 15:45128820-45128842 AGTTTGGTAAGAAACTGGGGAGG - Intronic
1128100524 15:64995373-64995395 AGTGTCTGAAGAAACACAGTAGG - Intergenic
1138438931 16:57022740-57022762 ATTTTCTGAAGGAGCTCGGAAGG + Intronic
1146351685 17:32100917-32100939 CTTTTCTGAAGAAACTTGAGAGG + Intergenic
1152534805 17:80944336-80944358 AGTTTCAGAATAAGCTCGGTAGG - Intronic
1153264743 18:3259154-3259176 ATTTTCAGAAGAAACTTGGATGG - Intergenic
1157149538 18:45202742-45202764 ACTTTATGATGAAACTCAGGTGG - Intergenic
1161920489 19:7262041-7262063 AGTATCTGAAAAGACTCTGGGGG + Intronic
1165694637 19:37891606-37891628 AGTTTCTGAAGAATCTGAAGTGG - Exonic
1167162976 19:47779630-47779652 AGTTTCTGTAGAGACGAGGGGGG - Intronic
925302211 2:2825523-2825545 AGACTCTGAAGAAACTGGGATGG + Intergenic
925579980 2:5400636-5400658 AGTTTCTAAAGAATCTAGAGAGG + Intergenic
928534302 2:32225274-32225296 ACTTCCTGAAGAGGCTCGGGAGG - Intronic
934995276 2:98952014-98952036 GGTTGCTGCAGAAACACGGGTGG + Intergenic
935331307 2:101979725-101979747 AGGTCCTGAAGAAGGTCGGGAGG + Intergenic
938970462 2:136426441-136426463 TGTTTCTGAAGAATCTGGGAAGG - Intergenic
939627103 2:144491148-144491170 AGTCTCTGAAGGAGCTGGGGTGG + Intronic
939868914 2:147506022-147506044 AGTTTTTGAAGAATATTGGGGGG - Intergenic
948071157 2:235127400-235127422 AGTATCTGAAGAAATACTGGTGG - Intergenic
948478877 2:238238633-238238655 AGTTTCTTAAGAAACGGGGCTGG + Exonic
1169672412 20:8117205-8117227 AGTTTCTGAGAAAATTCTGGAGG - Intergenic
1169957726 20:11124404-11124426 ATATTATGAAGAAACTTGGGAGG + Intergenic
1171052743 20:21875289-21875311 ATTTTCTCAAGAAACTGGTGAGG - Intergenic
1171903322 20:30877368-30877390 AGTTCCTGAAGAAGGTGGGGAGG - Intergenic
1173967855 20:47127155-47127177 TGTTTCTGAAGAATTTCTGGTGG - Intronic
1175874148 20:62221527-62221549 AGTTTCTGAAGCGCCACGGGGGG - Intergenic
1176361654 21:6001856-6001878 ATTTTCTAAAGAATCTCTGGAGG - Intergenic
1179761864 21:43536694-43536716 ATTTTCTAAAGAATCTCTGGAGG + Intronic
1180318549 22:11299907-11299929 AGTTCCTGAAGAAGGTTGGGAGG + Intergenic
1181940726 22:26474055-26474077 GGTTTCTGAAGAAAAGCTGGTGG - Intronic
1182985794 22:34714935-34714957 TGTTTCTGAACAAGCTGGGGTGG - Intergenic
950536659 3:13582807-13582829 AGGTTCTGCAGGAACTGGGGTGG + Intronic
952915958 3:38242213-38242235 GGTATCTAAAGAAACACGGGTGG - Intronic
954783997 3:53080046-53080068 AGTTTCTGAAGAAAGTGGAAAGG - Intronic
955316375 3:57942536-57942558 AGTTTCTTATGAAACCCTGGAGG + Intergenic
958158353 3:89785197-89785219 TATTACTGAAGAAACTGGGGAGG - Intergenic
960653397 3:119977181-119977203 AGTTTCTGAAGAGCCTAGGTAGG - Intronic
961599755 3:128051801-128051823 AGTTTCTGGAGAGACTTGGCCGG - Intronic
962646213 3:137443440-137443462 AATTTATGATGAAACTTGGGTGG - Intergenic
966871303 3:184291935-184291957 AGTTTTGGAAGGAACTTGGGAGG + Intronic
971630670 4:28988880-28988902 AGTTTGTGAGTAAACTAGGGAGG - Intergenic
971699241 4:29948103-29948125 AATTTCGGATGAAATTCGGGTGG - Intergenic
972036893 4:34534985-34535007 AGTTGCTGAAGAAATTCTGTAGG - Intergenic
973115094 4:46447113-46447135 AGTTTGTGAAGAAACATGGAAGG - Intronic
979296011 4:119032939-119032961 AGTTCCTTAAGTAACTGGGGAGG - Intronic
983680421 4:170347031-170347053 ATTTTCTCAAGAAAGTCAGGAGG + Intergenic
984681586 4:182616621-182616643 AGTTTCTGCAGATGCTCGTGTGG + Intronic
989839214 5:46039695-46039717 TGTTTTTGAAGAATCTCTGGTGG + Intergenic
996349756 5:122525442-122525464 AGCTTCTGAAGAAGCTCTGTGGG - Intergenic
997605944 5:135176107-135176129 AGTTTCTAAAGGAACAGGGGAGG + Intronic
998000398 5:138620586-138620608 AGGTGCTGAAGAAACTCGACAGG + Intronic
999737509 5:154523722-154523744 AGTTTCTCAAAAACCTCTGGAGG - Intergenic
1001909285 5:175501973-175501995 AGTTTTTGAAGAAAATTTGGTGG + Intronic
1002706348 5:181163014-181163036 AGTTTCTGTAGCTACTCGGGAGG - Intergenic
1002707533 5:181172579-181172601 GGTTTCTGTAGGTACTCGGGAGG - Intergenic
1002823025 6:746347-746369 AGCTTCATAAGAAACTCTGGGGG + Intergenic
1003424826 6:5991785-5991807 TCTTTCTGAAGACACTAGGGAGG + Intergenic
1007840464 6:44712029-44712051 AGTTTTTGAAAAAACAAGGGGGG + Intergenic
1012625079 6:101394318-101394340 AGCTTCTGAAAAAACTTGGAGGG + Intergenic
1013601994 6:111713545-111713567 AGGTTCTGAAGAAAGTGTGGGGG - Intronic
1015356615 6:132284981-132285003 AATTTCTGTAGAAACTCAGAAGG + Intergenic
1022123338 7:27331622-27331644 AGTTTCTGAAGAAAGAAGGGAGG - Intergenic
1023250427 7:38254448-38254470 AGTTTCTGGTGAAACTTGGAAGG - Intergenic
1023251730 7:38270546-38270568 AGTTTCTGGTGAAACTTGGAAGG - Intergenic
1023517747 7:41018696-41018718 AGTGTCTGAAGAAACTATGGAGG + Intergenic
1024038076 7:45525606-45525628 GGTTTCTCAAGGAACTCAGGAGG - Intergenic
1026597808 7:71749014-71749036 AGATTCTGAAGAACCTTGAGAGG - Intergenic
1027344622 7:77244969-77244991 AGTTCCTGAAGATATTGGGGTGG - Intronic
1033931803 7:146532455-146532477 AGTTTCAGAAGAAAGTGGGAAGG - Intronic
1037225786 8:16587922-16587944 AGTTTTTGAAGAGACTCTGCTGG - Intergenic
1038882823 8:31633729-31633751 TGTGTCTGAAGAAACTAAGGGGG - Intergenic
1039062315 8:33581559-33581581 AGTTTGTGAGTAAACTCCGGAGG + Intergenic
1044057900 8:87595279-87595301 AGTTTATGGTGAAGCTCGGGTGG - Intronic
1044552284 8:93525688-93525710 AGTTTCTGCAGAAACTAGACTGG + Intergenic
1047087434 8:121533987-121534009 GGTTTCTTAAGAAACTCCTGTGG + Intergenic
1048197807 8:132346895-132346917 AGCTTCTGGAGACACTAGGGAGG + Intronic
1048482978 8:134818526-134818548 AGTTTAAGAAGAAACTAGGTAGG + Intergenic
1051318850 9:15877466-15877488 AGTTTTTGAAGAAACAGGGAAGG - Intronic
1052108591 9:24550226-24550248 AGTTTCTTAACAATTTCGGGAGG + Intergenic
1053419528 9:37968632-37968654 AGTTTCTCAAGAAGGTCTGGGGG + Intronic
1055602655 9:77935849-77935871 TGTTTCTGAAGAAACTGAAGGGG - Intronic
1061052522 9:128204733-128204755 AGTTTCTGAAGAAGATGGGGGGG - Intronic
1061806998 9:133142242-133142264 AGTATCTGAGGAAACTCAGCAGG + Intronic
1203366781 Un_KI270442v1:265671-265693 AGTTCCTGAAGAAGGTTGGGAGG + Intergenic
1185552925 X:998369-998391 AGTTTATGAAGAAAGTAGAGGGG + Intergenic
1189662372 X:43314689-43314711 TGTGTGTGAAGAAACTGGGGAGG - Intergenic
1194305470 X:92241973-92241995 AGATACTGAACATACTCGGGAGG + Intronic
1201071896 Y:10154558-10154580 AGTTCCTGAAGAAGGTGGGGAGG - Intergenic