ID: 920038713

View in Genome Browser
Species Human (GRCh38)
Location 1:203082522-203082544
Sequence GATTCAGATTTAGCTCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920038713_920038717 -10 Left 920038713 1:203082522-203082544 CCTCCCCGAGCTAAATCTGAATC 0: 1
1: 0
2: 1
3: 2
4: 95
Right 920038717 1:203082535-203082557 AATCTGAATCTCCTTCATGCTGG 0: 1
1: 0
2: 2
3: 20
4: 137
920038713_920038723 30 Left 920038713 1:203082522-203082544 CCTCCCCGAGCTAAATCTGAATC 0: 1
1: 0
2: 1
3: 2
4: 95
Right 920038723 1:203082575-203082597 CACAATCCCCTTCGGCCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 84
920038713_920038718 -9 Left 920038713 1:203082522-203082544 CCTCCCCGAGCTAAATCTGAATC 0: 1
1: 0
2: 1
3: 2
4: 95
Right 920038718 1:203082536-203082558 ATCTGAATCTCCTTCATGCTGGG 0: 1
1: 1
2: 2
3: 16
4: 137
920038713_920038721 22 Left 920038713 1:203082522-203082544 CCTCCCCGAGCTAAATCTGAATC 0: 1
1: 0
2: 1
3: 2
4: 95
Right 920038721 1:203082567-203082589 GCAGGAACCACAATCCCCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
920038713_920038720 4 Left 920038713 1:203082522-203082544 CCTCCCCGAGCTAAATCTGAATC 0: 1
1: 0
2: 1
3: 2
4: 95
Right 920038720 1:203082549-203082571 TCATGCTGGGAGCTGCAAGCAGG 0: 1
1: 4
2: 171
3: 1344
4: 3449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920038713 Original CRISPR GATTCAGATTTAGCTCGGGG AGG (reversed) Intergenic
905796401 1:40818853-40818875 GATTCTGAATTAGGTAGGGGCGG + Intronic
907496495 1:54848635-54848657 GATTCAGATTTGGAACTGGGAGG + Intergenic
908242893 1:62202837-62202859 AATACAGATTTAGCTGGGCGTGG - Intronic
911489619 1:98547343-98547365 AATTCAGAATTAGCTGTGGGTGG + Intergenic
912983151 1:114397835-114397857 GATTCAGAAGTAGCTCAGGCAGG - Exonic
913330891 1:117666572-117666594 TATTCAGCTTTAGCTGGGTGTGG - Intergenic
913681256 1:121188128-121188150 TATTCAGATTTAGGTGAGGGCGG - Intronic
914033086 1:143975768-143975790 TATTCAGATTTAGGTGAGGGCGG - Intergenic
914156359 1:145092198-145092220 TATTCAGATTTAGGTGAGGGCGG + Intronic
915371348 1:155353748-155353770 CATTCAGATTCAGCTGGGGACGG - Intronic
918054580 1:181008922-181008944 AAATGAGATTTTGCTCGGGGCGG + Intronic
920006715 1:202838639-202838661 GATTCAAATTTGGCTGGGTGTGG + Intergenic
920038713 1:203082522-203082544 GATTCAGATTTAGCTCGGGGAGG - Intergenic
920468571 1:206206653-206206675 TATTCAGATTTAGGTGAGGGCGG - Intronic
922823216 1:228498650-228498672 GATACTGCTTTAGCTCGGGGTGG + Intergenic
923050190 1:230385913-230385935 GATTCAGATTTAGCAGGGCTAGG - Intronic
1064007527 10:11710321-11710343 AATTCAGAATTAGCTGGGTGTGG - Intergenic
1065383979 10:25115524-25115546 GATTCAGATTTAACATGAGGGGG + Intergenic
1070752947 10:78974499-78974521 GATTCATCTTTGGCCCGGGGAGG - Intergenic
1071786846 10:88910427-88910449 GATCCAGATTAGGCTTGGGGGGG + Intronic
1071796373 10:89010753-89010775 GATCCAGATCTAACTTGGGGTGG + Exonic
1075429435 10:122368244-122368266 GATTCAGATTGGGCTGGGGTAGG + Intergenic
1088285446 11:108182778-108182800 AATTAAGATTTAGCTGGGTGTGG - Intronic
1092616326 12:10219026-10219048 AATTCAGCTTTGGCTGGGGGTGG + Intronic
1097814724 12:64060094-64060116 GATTCTGAAATAGGTCGGGGTGG + Intronic
1098204441 12:68093263-68093285 GATTCAGGTTTACCTCTGGTGGG - Intergenic
1100240273 12:92704103-92704125 GATTCAAAATTAGCTGGGTGGGG + Intronic
1100377549 12:94031332-94031354 GATTCAGATTCAGTTCGTGTGGG - Intergenic
1103058886 12:117842968-117842990 GGTTCAGATTCAGCTTGGGAAGG + Intronic
1103429232 12:120867901-120867923 GATACAAATTTAGCTGGGTGTGG - Intronic
1104295995 12:127513962-127513984 GATTCAAATTTGGCTGGGCGCGG - Intergenic
1113660169 13:112102117-112102139 GATTCAGAACTGGCTGGGGGTGG + Intergenic
1121362126 14:93271337-93271359 GATTCATATTGAGGTCGGGGTGG + Intronic
1121405552 14:93717371-93717393 GCTTCAGAGTTAGCTCAGTGAGG - Intergenic
1122272500 14:100574462-100574484 GGGCCAGATTTAGCTCCGGGAGG - Intronic
1129929579 15:79399199-79399221 GATTAAGATTTTGCTGGGTGTGG - Intronic
1130637918 15:85642737-85642759 GATCCAGATTCAGCCCTGGGAGG - Intronic
1132050826 15:98606437-98606459 GATTCAGAACCAGCTCAGGGAGG - Intergenic
1133848124 16:9476261-9476283 GAGTCAAATTGAGCTGGGGGTGG + Intergenic
1139677684 16:68536392-68536414 GAATCAGCTTGAGCTAGGGGAGG - Intronic
1140533561 16:75688659-75688681 GCTTAAGATTTAGCAGGGGGTGG - Intronic
1146322803 17:31859411-31859433 GTTTCAGATTTCGCGCTGGGAGG - Intergenic
1149925389 17:60697268-60697290 GATTCAGTTTTGGCTGGGCGTGG + Intronic
1151038180 17:70825579-70825601 AATTCAGATTCAGCTAGGGCAGG - Intergenic
1152752946 17:82074063-82074085 GATCAAGATTTGGCTGGGGGCGG + Intergenic
1153619626 18:6965111-6965133 GATTCACATTTTGCTGGAGGAGG - Intronic
1155039849 18:22055745-22055767 GATAATGATTTAGCTGGGGGTGG + Intergenic
1157586253 18:48803203-48803225 GATCCAGATTTAGCTGGAAGTGG + Intronic
1158819191 18:61138953-61138975 AATTCAGATTTATTTCTGGGAGG - Intergenic
1159051345 18:63423528-63423550 AATTCAGCTTAAGCTCAGGGAGG - Intergenic
1163150639 19:15411286-15411308 GTTTCAGATTTAGAACAGGGAGG - Intronic
1167183715 19:47925232-47925254 AATTGAGGCTTAGCTCGGGGGGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
931946411 2:67313368-67313390 CAGTCAAATTTAGCTTGGGGTGG + Intergenic
946478450 2:220031199-220031221 GATTCATTTTTAGCTCAGAGAGG - Intergenic
947216568 2:227755294-227755316 GATTCAGATTTGAGTGGGGGAGG - Intergenic
1178711927 21:34924822-34924844 GATTAAGATTCAGCTCTGGAGGG + Intronic
955038434 3:55291691-55291713 GATTCAAATTCAGCTTGGCGTGG + Intergenic
959656297 3:108808616-108808638 GATTCAGATTCAGGGAGGGGAGG - Intergenic
960222046 3:115124492-115124514 AATTAAAATTTAGCTTGGGGAGG + Intronic
961587988 3:127950257-127950279 AATTCAGAATTATCTCAGGGAGG + Intronic
963155111 3:142087946-142087968 GATTCAGCTTTAGATGGGGTGGG - Intronic
968584190 4:1408318-1408340 TATCCAAATTTAGCTGGGGGAGG - Intergenic
970479979 4:16462993-16463015 GTTTCTGAATTAGATCGGGGAGG + Intergenic
972647283 4:40981146-40981168 GAATCAGAATTAGCTTTGGGAGG + Intronic
980120565 4:128723844-128723866 AATGCAAATTTAGCTGGGGGTGG + Intergenic
981183137 4:141769216-141769238 GATTCAGATTAATCCCGTGGTGG - Intergenic
982854167 4:160360927-160360949 AATACAGAATTAGCTGGGGGTGG - Intergenic
984083161 4:175275056-175275078 GATTCTGATTTAGCTATGGTGGG + Intergenic
993823357 5:92648974-92648996 AATTAAAATTTAGCTCGGTGTGG - Intergenic
1000323351 5:160152720-160152742 AATACAGAATTAGCTGGGGGTGG - Intergenic
1002180749 5:177429908-177429930 GATTCAGACCCAGCTCTGGGAGG + Intronic
1005797065 6:29375696-29375718 AATTCAGATGTAGCTCAGTGGGG + Intronic
1007171995 6:39870564-39870586 GATTCAGAATCAGCTCTGTGGGG + Intronic
1007759971 6:44127851-44127873 GACTCACATTTGGCTCGGGATGG - Intronic
1011421425 6:87177169-87177191 AATACAGAATTAGCTGGGGGTGG + Intronic
1011750078 6:90446784-90446806 GATTCAGATTTAGATTGAGCAGG + Intergenic
1015613949 6:135055205-135055227 GAATCAGATTTAGCCCAGGCCGG + Intronic
1022339346 7:29453742-29453764 GATTTAGATTTAGCCTGGGTAGG - Intronic
1023153662 7:37226150-37226172 GATCCAGATGTAGCTGGGGTAGG - Intronic
1023406623 7:39840563-39840585 GATTTAGAACTAGCTCTGGGTGG + Intergenic
1026900810 7:74036472-74036494 GATTCAGCCATAGCTGGGGGTGG + Intronic
1030491859 7:110245996-110246018 GACTCAGATTTAGCTTTGGTTGG + Intergenic
1031469210 7:122149087-122149109 GATTTAGATTTACCTGTGGGTGG - Intergenic
1035198184 7:157240559-157240581 GAGTCAGATTTAACCAGGGGTGG + Intronic
1036837355 8:12084644-12084666 GATACAAATTTAGCTGGGCGCGG + Intergenic
1036859148 8:12330888-12330910 GATACAAATTTAGCTGGGCGCGG + Intergenic
1038586812 8:28797111-28797133 GTTTCAGATTCAGGTTGGGGTGG + Intronic
1043765026 8:84120237-84120259 GATCCAGACTTAGCTTAGGGTGG - Intergenic
1048179126 8:132179326-132179348 GATTCTGATCTACCTGGGGGAGG + Intronic
1050497107 9:6254827-6254849 GATTCTGATTTATTTCTGGGGGG - Intronic
1052587400 9:30447088-30447110 GAGACAGATTTAGATAGGGGTGG - Intergenic
1062723278 9:138056252-138056274 GATTCATAGTTGGCTAGGGGTGG - Intronic
1185527916 X:793923-793945 CATGGAGATTTAGCTGGGGGTGG - Intergenic
1186979140 X:14940074-14940096 GATTCTGATTCAGATCTGGGTGG - Intergenic
1187670607 X:21662317-21662339 AATTTAGATTTAGCTAGGGAGGG - Intergenic
1187910336 X:24105418-24105440 GTTTCAGAATTAGATCGTGGTGG - Intergenic
1189539063 X:41967263-41967285 GATTCAGATTTAGCTGGAGGTGG - Intergenic
1192570255 X:72197791-72197813 GAGTCAGATATAGTTCTGGGAGG - Exonic