ID: 920039331

View in Genome Browser
Species Human (GRCh38)
Location 1:203085507-203085529
Sequence GACCTCCGCTACCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920039331_920039343 8 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039343 1:203085538-203085560 CCTGGTTGAGGGAGCTGAGCAGG 0: 1
1: 1
2: 4
3: 24
4: 333
920039331_920039345 14 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039331_920039338 -10 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039338 1:203085520-203085542 AGCGGAGGTCACGCTCCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 108
920039331_920039346 17 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039331_920039344 9 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039344 1:203085539-203085561 CTGGTTGAGGGAGCTGAGCAGGG 0: 1
1: 1
2: 1
3: 35
4: 316
920039331_920039340 -3 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039340 1:203085527-203085549 GTCACGCTCCTCCTGGTTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
920039331_920039339 -4 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039339 1:203085526-203085548 GGTCACGCTCCTCCTGGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920039331 Original CRISPR GACCTCCGCTACCGGGGCGG GGG (reversed) Exonic