ID: 920039331

View in Genome Browser
Species Human (GRCh38)
Location 1:203085507-203085529
Sequence GACCTCCGCTACCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920039331_920039345 14 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039331_920039338 -10 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039338 1:203085520-203085542 AGCGGAGGTCACGCTCCTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 108
920039331_920039346 17 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039331_920039344 9 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039344 1:203085539-203085561 CTGGTTGAGGGAGCTGAGCAGGG 0: 1
1: 1
2: 1
3: 35
4: 316
920039331_920039343 8 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039343 1:203085538-203085560 CCTGGTTGAGGGAGCTGAGCAGG 0: 1
1: 1
2: 4
3: 24
4: 333
920039331_920039339 -4 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039339 1:203085526-203085548 GGTCACGCTCCTCCTGGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 100
920039331_920039340 -3 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039340 1:203085527-203085549 GTCACGCTCCTCCTGGTTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920039331 Original CRISPR GACCTCCGCTACCGGGGCGG GGG (reversed) Exonic
900109126 1:998263-998285 AACCTCCCTTACCGGGGCAGGGG + Intergenic
900314873 1:2051502-2051524 GACCTCCGCTCCCGCGAGGGTGG + Intronic
905018504 1:34793135-34793157 GTCCTCCGATGCCGGGACGGGGG + Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
905959954 1:42035527-42035549 AACCTCCGGTCCTGGGGCGGGGG - Intronic
906289386 1:44610069-44610091 GCACTCCGCGACTGGGGCGGTGG + Intronic
910395454 1:86789198-86789220 GAGCTGTGGTACCGGGGCGGGGG + Intergenic
917846727 1:179026130-179026152 GACCCCCGCCCCCGGCGCGGCGG + Intronic
920039331 1:203085507-203085529 GACCTCCGCTACCGGGGCGGGGG - Exonic
1072613058 10:97031738-97031760 GACCTCCACGTCCTGGGCGGCGG - Intronic
1072719504 10:97771937-97771959 GACCTCCGCGGCGGCGGCGGCGG - Exonic
1105502876 13:20988331-20988353 GCCCTCCGCAGCCGGGGCGGGGG + Exonic
1127433376 15:58933541-58933563 GGCTGCCGCTACCGGTGCGGTGG - Exonic
1130990897 15:88875089-88875111 GACCTCCGCTGCCTGGGAGTTGG + Exonic
1132314457 15:100879910-100879932 GGCCACCGCTAACGGGGCCGTGG + Exonic
1138590430 16:57996547-57996569 GCCCTCCGCTGCCGCGGCGGCGG + Exonic
1149751910 17:59154497-59154519 GAGCTCCGCTCCCGGAGCGCGGG - Intronic
1151919188 17:77140982-77141004 GACCGCCGGTTCCGGGGAGGGGG - Intronic
1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG + Exonic
1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG + Intronic
925381345 2:3428798-3428820 GACCTCAGCTCCGGGGGCGCGGG - Intronic
925989224 2:9240370-9240392 GATCCCAGCTACCGGGGAGGTGG - Intronic
929604506 2:43225990-43226012 CACCTCGGCAGCCGGGGCGGAGG - Intronic
932496762 2:72149417-72149439 GACCTCCGCTGCCGGGGCTTCGG - Intergenic
1174556801 20:51401249-51401271 AACCTCAGCTACCTGGGAGGCGG + Intronic
1176555515 21:8252678-8252700 GACCGCCGCGACTGCGGCGGTGG + Intergenic
1178707761 21:34889203-34889225 GGCCTCCGCTTCCAGGGCGGGGG + Intronic
1179209721 21:39314212-39314234 GACCCGCGCTCCTGGGGCGGGGG + Intronic
1180609362 22:17085514-17085536 GAACTCCGCGGCCCGGGCGGAGG - Intronic
1181085158 22:20436480-20436502 GAGCCCCGCCTCCGGGGCGGGGG - Intronic
1182131415 22:27855610-27855632 CACCTCCGGTTCCGGGGTGGGGG - Intronic
1184121979 22:42457552-42457574 GACCTCCGCCTCCGGGGCTCGGG + Intergenic
1184187795 22:42876390-42876412 GCCCTCCCCTTGCGGGGCGGGGG - Intronic
950345524 3:12288466-12288488 GACCTCCGCGTCCCCGGCGGAGG + Intronic
964569725 3:158098117-158098139 GGCCGCCACTACCGAGGCGGCGG + Exonic
968514569 4:1010844-1010866 AATCTCCGCTACCGGGCAGGCGG - Intronic
991587757 5:68216511-68216533 GCCCTCCTCTTCCGGGGTGGGGG + Intronic
998136539 5:139677077-139677099 GACCGCGGCTGGCGGGGCGGCGG + Intronic
1005900691 6:30214168-30214190 GACGTCAGCTTCCGGGGCCGTGG - Intergenic
1010318419 6:74477738-74477760 GACCACCTCTACCAGGGTGGTGG - Intergenic
1018758634 6:166871423-166871445 GCCCTCCGCTCCCGGGGTAGAGG + Intronic
1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG + Intronic
1020248304 7:6447720-6447742 GACGGCGGCTACGGGGGCGGTGG - Intronic
1022103807 7:27184601-27184623 GACCTCCGCGGCGGCGGCGGCGG - Exonic
1028373430 7:90119629-90119651 TACCTCCGGCTCCGGGGCGGAGG - Intergenic
1031688927 7:124765079-124765101 GTTCCCCGCTACCCGGGCGGGGG - Exonic
1035335383 7:158124704-158124726 GAGCCCAGCTGCCGGGGCGGAGG + Intronic
1036162884 8:6406126-6406148 GACCTCCGATCCCGGGGATGGGG - Intergenic
1037814110 8:22102906-22102928 GACCTGCCCTTCCGGGGCTGGGG - Exonic
1044229537 8:89758118-89758140 GACCTGCGCTACCTGAGCCGCGG + Exonic
1186206095 X:7202480-7202502 GACCTCCTCTTCCGGGGAAGGGG + Intergenic
1186669475 X:11755432-11755454 GGCCTCTGCCAGCGGGGCGGCGG + Intergenic
1191842378 X:65522477-65522499 GAGCTCAGCTACCCGGGCTGAGG + Intronic
1200209700 X:154341761-154341783 GCCCGCCGCTGCCGGGGCGTCGG - Intergenic
1200221152 X:154390331-154390353 GCCCGCCGCTGCCGGGGCGTCGG + Intronic