ID: 920039345

View in Genome Browser
Species Human (GRCh38)
Location 1:203085544-203085566
Sequence TGAGGGAGCTGAGCAGGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 0, 2: 3, 3: 90, 4: 753}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920039331_920039345 14 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039336_920039345 7 Left 920039336 1:203085514-203085536 CCCGGTAGCGGAGGTCACGCTCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039333_920039345 12 Left 920039333 1:203085509-203085531 CCCGCCCCGGTAGCGGAGGTCAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039334_920039345 11 Left 920039334 1:203085510-203085532 CCGCCCCGGTAGCGGAGGTCACG 0: 1
1: 0
2: 0
3: 6
4: 116
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039324_920039345 30 Left 920039324 1:203085491-203085513 CCCTGGCTGGGGCCCGCCCCCGC 0: 1
1: 0
2: 1
3: 41
4: 401
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039328_920039345 18 Left 920039328 1:203085503-203085525 CCCGCCCCCGCCCCGGTAGCGGA 0: 1
1: 0
2: 2
3: 14
4: 192
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039335_920039345 8 Left 920039335 1:203085513-203085535 CCCCGGTAGCGGAGGTCACGCTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039325_920039345 29 Left 920039325 1:203085492-203085514 CCTGGCTGGGGCCCGCCCCCGCC 0: 1
1: 1
2: 7
3: 93
4: 1044
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039337_920039345 6 Left 920039337 1:203085515-203085537 CCGGTAGCGGAGGTCACGCTCCT 0: 1
1: 0
2: 0
3: 3
4: 21
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039329_920039345 17 Left 920039329 1:203085504-203085526 CCGCCCCCGCCCCGGTAGCGGAG 0: 1
1: 0
2: 1
3: 13
4: 222
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753
920039332_920039345 13 Left 920039332 1:203085508-203085530 CCCCGCCCCGGTAGCGGAGGTCA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 920039345 1:203085544-203085566 TGAGGGAGCTGAGCAGGGCCTGG 0: 1
1: 0
2: 3
3: 90
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920039345 Original CRISPR TGAGGGAGCTGAGCAGGGCC TGG Exonic