ID: 920039346

View in Genome Browser
Species Human (GRCh38)
Location 1:203085547-203085569
Sequence GGGAGCTGAGCAGGGCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1145
Summary {0: 1, 1: 0, 2: 12, 3: 142, 4: 990}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920039335_920039346 11 Left 920039335 1:203085513-203085535 CCCCGGTAGCGGAGGTCACGCTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039332_920039346 16 Left 920039332 1:203085508-203085530 CCCCGCCCCGGTAGCGGAGGTCA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039329_920039346 20 Left 920039329 1:203085504-203085526 CCGCCCCCGCCCCGGTAGCGGAG 0: 1
1: 0
2: 1
3: 13
4: 222
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039333_920039346 15 Left 920039333 1:203085509-203085531 CCCGCCCCGGTAGCGGAGGTCAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039337_920039346 9 Left 920039337 1:203085515-203085537 CCGGTAGCGGAGGTCACGCTCCT 0: 1
1: 0
2: 0
3: 3
4: 21
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039328_920039346 21 Left 920039328 1:203085503-203085525 CCCGCCCCCGCCCCGGTAGCGGA 0: 1
1: 0
2: 2
3: 14
4: 192
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039334_920039346 14 Left 920039334 1:203085510-203085532 CCGCCCCGGTAGCGGAGGTCACG 0: 1
1: 0
2: 0
3: 6
4: 116
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039331_920039346 17 Left 920039331 1:203085507-203085529 CCCCCGCCCCGGTAGCGGAGGTC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990
920039336_920039346 10 Left 920039336 1:203085514-203085536 CCCGGTAGCGGAGGTCACGCTCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 920039346 1:203085547-203085569 GGGAGCTGAGCAGGGCCTGGAGG 0: 1
1: 0
2: 12
3: 142
4: 990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920039346 Original CRISPR GGGAGCTGAGCAGGGCCTGG AGG Exonic