ID: 920039856

View in Genome Browser
Species Human (GRCh38)
Location 1:203088553-203088575
Sequence AAGCCAAAACTGCTGAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920039851_920039856 15 Left 920039851 1:203088515-203088537 CCAGTAGTTTCTTCAAAAGCGTT 0: 1
1: 0
2: 2
3: 12
4: 153
Right 920039856 1:203088553-203088575 AAGCCAAAACTGCTGAAGACTGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920039856 Original CRISPR AAGCCAAAACTGCTGAAGAC TGG Intergenic
901362857 1:8718674-8718696 AGGCTAAATTTGCTGAAGACTGG - Intronic
904481237 1:30794912-30794934 AGGCCAAACCTGCTAAAGAGAGG - Intergenic
904726153 1:32549807-32549829 AAGACAAACATGGTGAAGACAGG - Intronic
907630955 1:56081321-56081343 AAGCCCAAACAGCAGAAGGCCGG + Intergenic
908577045 1:65471046-65471068 AAGACAATACTCCTGATGACTGG + Intronic
908857777 1:68449007-68449029 AAGGAAAAACTGCAGAGGACAGG - Intronic
909399342 1:75209250-75209272 TAGCCAAAACTTCCAAAGACTGG + Intronic
910217337 1:84855595-84855617 AAGCCAGAAGTTCTGAAGAAGGG + Intronic
911880407 1:103231381-103231403 TATCCAAAACTGATGAAGATAGG - Intergenic
913253156 1:116929291-116929313 AAGCAAAAGCTGATGAACACCGG - Intronic
916647002 1:166796652-166796674 AAGACAAAGCTGCTGCAGAATGG + Intergenic
918671875 1:187227841-187227863 AAGCGAACACTGATGAAGCCAGG + Intergenic
918701067 1:187608594-187608616 AACCCAAAATTGTTGAAGAAAGG + Intergenic
920039856 1:203088553-203088575 AAGCCAAAACTGCTGAAGACTGG + Intergenic
920522517 1:206638835-206638857 AAGCAAAAACTGATGACCACAGG - Intronic
921339265 1:214118186-214118208 CTGCCTAAACTGCAGAAGACTGG - Intergenic
923634138 1:235678415-235678437 AAGCCATAACTGCTGAGTATCGG - Intronic
1063130111 10:3170967-3170989 AAGAAAAAAATGCTGAAGATTGG + Intronic
1063400304 10:5737391-5737413 AAGCCAAAACTGCAGCATATGGG - Intronic
1064793040 10:18980346-18980368 AAGCCAACACAGAGGAAGACAGG + Intergenic
1065028783 10:21564594-21564616 TAGCCAAAACTGATGAACAGAGG - Intronic
1065664085 10:28039562-28039584 AAGAAAAACCTGCTAAAGACAGG - Intergenic
1065778669 10:29145985-29146007 AAGCTAAGACTCCTGATGACTGG + Intergenic
1068118617 10:52761615-52761637 AAGAAGAAACTGCTGAGGACAGG - Intergenic
1074934002 10:118159671-118159693 AGGCCAAAAATGCTAGAGACTGG + Intergenic
1078084069 11:8223332-8223354 CAGCCAGAACTGCAGCAGACAGG - Intergenic
1079787481 11:24692279-24692301 AAGCAAAAAGTGCTGAAAAATGG + Intronic
1081832520 11:46125664-46125686 AAACAAAAACTGCTGAACAAAGG + Intergenic
1086219231 11:84421283-84421305 CAGCCCAAACTGATTAAGACAGG + Intronic
1092228379 12:6763839-6763861 AAGCCAAGACTTCAGAAGACTGG + Intronic
1095364786 12:41389930-41389952 AATCCCAAAGTGCTTAAGACTGG - Intronic
1100738245 12:97562109-97562131 AAGCCAACATTGCTGAAGGTTGG - Intergenic
1101169904 12:102080752-102080774 AAGGCTAGGCTGCTGAAGACTGG + Intronic
1101214666 12:102568556-102568578 AAGCCATCACTGCTGAATAATGG - Intergenic
1101734042 12:107449497-107449519 ATTCCAAAACAGCTGAAGATGGG - Intronic
1103126818 12:118430587-118430609 AAGGCAAAACTGCAGATGAGGGG - Intergenic
1103772246 12:123337015-123337037 AAACCAAAACCCCAGAAGACTGG + Intronic
1104442814 12:128808733-128808755 AATCCACAACTGCTGCAGTCGGG + Intronic
1105244074 13:18632089-18632111 AAGCTAAAACTCTTGAAAACAGG + Intergenic
1106283681 13:28300219-28300241 AAGCAAATGCTGCTGAAGAGAGG - Intergenic
1109043955 13:57382722-57382744 AAGCCCAAACTGACTAAGACAGG + Intergenic
1110416016 13:75253582-75253604 AAGCAAGAACTGCTAAAAACAGG + Intergenic
1110603151 13:77399629-77399651 AAGCTAAAACTTCAGAAGAGTGG + Intergenic
1114617077 14:24074075-24074097 AAGCCATTATTGCTGAAGAATGG + Exonic
1114987231 14:28245398-28245420 AAGTAAAAAGTGCTGAAGAAAGG - Intergenic
1115300246 14:31877256-31877278 CAGCAAAAAGTGCTGAAGAAAGG - Intergenic
1115900389 14:38140749-38140771 GACCCAAACCTGCTGAAGAAGGG - Intergenic
1116955032 14:50914600-50914622 AAGCCAGCCCTGCTGCAGACTGG + Intronic
1118706760 14:68487195-68487217 AAACCAAACCTGCTGGAGCCTGG - Intronic
1125042297 15:35204233-35204255 AAGCCTTAATTTCTGAAGACAGG - Intergenic
1128800207 15:70492394-70492416 AAGTCATAACTGCTGGAGACAGG - Intergenic
1129379269 15:75155073-75155095 AAGCCAGAAGTGCTGAAGCCTGG + Intergenic
1129461167 15:75700697-75700719 CAGCAGAAACTGCTGAAGACAGG + Intronic
1129723663 15:77891045-77891067 CAGCAGAAACTGCCGAAGACAGG - Intergenic
1130253423 15:82315031-82315053 GGGCCAAGAGTGCTGAAGACAGG - Intergenic
1130309067 15:82736904-82736926 AACCTAAAAATGCTGAAGGCTGG + Intergenic
1132003764 15:98207470-98207492 AAGCCAGCACTTATGAAGACAGG + Intergenic
1133753316 16:8742097-8742119 AAGCCAGGAATGCTGAGGACAGG - Intronic
1135749321 16:25044301-25044323 CAGCCAACACTACTGAAGACAGG - Intergenic
1138765661 16:59599757-59599779 AAGGCAAAACTTCTGGAGATGGG + Intergenic
1138826576 16:60327953-60327975 AATCTAAAGCTGCTGAGGACAGG + Intergenic
1139113109 16:63916636-63916658 AAGCCAAAGCTGCTCATGAATGG - Intergenic
1139385329 16:66565189-66565211 AAGCCAAACTTCCTGATGACTGG + Intronic
1139659619 16:68411829-68411851 CATCAAAAAGTGCTGAAGACTGG + Intronic
1144596424 17:16574025-16574047 AAGCCAAATCTTCAGAAGTCAGG + Intergenic
1146778896 17:35649023-35649045 AATCAAAAACTGCTAAAGAGAGG - Intronic
1147327263 17:39675452-39675474 AGGCCCAAACTGCTGAAAGCAGG + Intronic
1148371535 17:47103323-47103345 AAGCCAAAACTGTTTAGGAAGGG + Intergenic
1149211281 17:54304434-54304456 ATGCCAAAACATCTGATGACAGG + Intergenic
1151256671 17:72882720-72882742 GACCCAATACTGCTGAAGTCAGG - Intronic
1153481610 18:5552960-5552982 AAGTCAAAACTGTTGAATATTGG - Intronic
1154444868 18:14427811-14427833 AAGCTAAAACTCTTGAAAACAGG - Intergenic
1155953953 18:31941867-31941889 AATCCAAAACTGGAGAAAACGGG + Intronic
1156391225 18:36652392-36652414 AAACCAAAGCTGCTGGTGACAGG + Intronic
1156485018 18:37459684-37459706 AAGACAGAGCTGCTGAAGATCGG - Intronic
1157576317 18:48746218-48746240 AAGCTAAAAGTGCTGACCACAGG - Intronic
1158761490 18:60393648-60393670 AAGGCAGACCTGATGAAGACAGG - Intergenic
1158965871 18:62621841-62621863 CACCCAAAACTGATGTAGACGGG + Intergenic
1162182623 19:8880462-8880484 AAACTAAAACTCCTGAAGATGGG + Intronic
1165793934 19:38507601-38507623 AAGCCAAAGCTGATAGAGACGGG + Intronic
926778337 2:16444321-16444343 ACACCTAAACTTCTGAAGACGGG + Intergenic
927197172 2:20555986-20556008 AAGGTAAAAGTGCTGTAGACAGG + Intergenic
927757585 2:25721672-25721694 AGGCCAAATGAGCTGAAGACAGG - Intergenic
928734844 2:34276249-34276271 CAGCAAAAACTGCTAAAGAAAGG + Intergenic
931485538 2:62687081-62687103 AAGTCAAAACAGCTGAAGACAGG - Intronic
931486156 2:62694760-62694782 AAGCCAAAACAGAGGAAGCCAGG - Intronic
933244255 2:79957486-79957508 AAACCAAAGCAGCTGTAGACAGG - Intronic
934115093 2:88781548-88781570 AAGGCCAAACTGCTGAATCCAGG + Intergenic
937029837 2:118729701-118729723 AAGGCAAAAGAGCTGAAGACAGG - Intergenic
937329247 2:121015233-121015255 TAGACAAAACAACTGAAGACAGG + Intergenic
939595319 2:144115711-144115733 AAGACAAAAGTGCTGCAGAAAGG - Intronic
947420447 2:229937625-229937647 AAGCCAACACTGCTGAAGCAGGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169678362 20:8180600-8180622 AGGCCAAAAGTGATGAATACAGG + Intronic
1170122841 20:12928730-12928752 CAGCCAGAGCTGATGAAGACAGG - Intergenic
1171373693 20:24677708-24677730 AAGCCACAGCTCCTGAAGAATGG + Intergenic
1175531424 20:59675982-59676004 AAACAAAAAATGCTGAAGCCAGG - Intronic
1176390439 21:6160397-6160419 GACCCAAAACTGCTGGTGACTGG + Intergenic
1176451119 21:6862060-6862082 AAGCTAAAACTCTTGAAAACAGG + Intergenic
1176829288 21:13727111-13727133 AAGCTAAAACTCTTGAAAACAGG + Intergenic
1177452991 21:21296283-21296305 AACCCAATGCAGCTGAAGACAGG + Intronic
1178374481 21:32055527-32055549 AAGCCAGAACTTCTGAAGGCTGG - Intergenic
1179733028 21:43377843-43377865 GACCCAAAACTGCTGGTGACTGG - Intergenic
950037499 3:9897650-9897672 AAGCCAACACTGCTCAACAAGGG - Intergenic
955166931 3:56524070-56524092 CAGCCCAAACTGATTAAGACGGG + Intergenic
955458025 3:59145953-59145975 AAGACAAATCTGCCAAAGACAGG - Intergenic
956671567 3:71696383-71696405 AAGCACAAAATGCTGATGACAGG + Intronic
956973795 3:74556969-74556991 AAGACAAACCTGTTGAAAACTGG - Intergenic
958886214 3:99730315-99730337 AATTCAAAACTGGTGAAGATAGG + Intronic
959400877 3:105900796-105900818 AAGCCATAAAAGATGAAGACTGG + Intergenic
960362131 3:116725649-116725671 CAGCTACACCTGCTGAAGACGGG + Intronic
960488520 3:118281944-118281966 TAGCCAAAAAGGCTGAAGAGTGG + Intergenic
963318128 3:143783199-143783221 AAGTCCAAACTGCAGAACACAGG + Intronic
965505468 3:169510307-169510329 AAGTCAAGACTGCTGGTGACAGG - Intronic
966064483 3:175801525-175801547 AAGCTAAAAGAGATGAAGACAGG - Intronic
966422320 3:179745662-179745684 ATTACAAAAATGCTGAAGACAGG + Intronic
969185167 4:5469264-5469286 AAGCCAAAACGGTTGAATACTGG - Intronic
972649874 4:41006415-41006437 AGGGCAAACCAGCTGAAGACTGG + Intronic
975491013 4:74988911-74988933 AAGCCAAAACCACTGAGGAAAGG + Intronic
977782447 4:100995277-100995299 AAGCCTAAACTGCAGAGGCCAGG - Intergenic
981287554 4:143036897-143036919 AAACCAAAACTCTAGAAGACAGG + Intergenic
981762698 4:148211070-148211092 CAGAGCAAACTGCTGAAGACAGG + Intronic
986495141 5:8333761-8333783 AAGCCAAAAATATTGAAGGCAGG + Intergenic
987376366 5:17239081-17239103 AAAAAAAAACAGCTGAAGACAGG - Intronic
989440272 5:41463176-41463198 TAGCCAGAACTGATGAATACAGG - Intronic
993250766 5:85519259-85519281 GAGCCAAGACTGCTGAGGACTGG - Intergenic
994092510 5:95821693-95821715 AAGCCAAGGATGCTGAAGAGAGG + Intronic
994409560 5:99389614-99389636 AAGCCAAGACAGATGATGACTGG + Intergenic
994632281 5:102300802-102300824 TATCCAAATCTGCTGAATACAGG - Intergenic
994942149 5:106338502-106338524 AAGCCAACATTTCTGAGGACAGG - Intergenic
996115131 5:119609656-119609678 AAGCCAAAACTCCTTAGGTCAGG + Intronic
998244153 5:140481729-140481751 AAGAAAAAACTGATAAAGACTGG - Intronic
1001473693 5:172034171-172034193 AAGCGAACTGTGCTGAAGACCGG - Intergenic
1004203017 6:13567253-13567275 AAGACAGAATTGGTGAAGACTGG + Intergenic
1005856302 6:29865575-29865597 AAGACAAAACTGCCCAAGAGTGG + Intergenic
1006564503 6:34943249-34943271 AACCTAAAACTGCTGTAGGCCGG - Intronic
1007506924 6:42342731-42342753 CAGCCAAGACTGTTGAAGACAGG - Intronic
1008288830 6:49687588-49687610 ATGCCAAAACTGCTGGAGTTGGG + Intergenic
1008384658 6:50875160-50875182 AACCTAAAATAGCTGAAGACTGG + Intergenic
1011826787 6:91316960-91316982 AAACCAAAAATACTGAACACAGG - Intergenic
1012608123 6:101183269-101183291 AAGCCAGAAGGGCTGAAGAGAGG - Intergenic
1013320918 6:108988310-108988332 ATGCCAGCACTTCTGAAGACGGG + Intronic
1016864424 6:148751003-148751025 ATCCCAAAGCTGCTGAAGTCTGG + Intronic
1017365004 6:153625442-153625464 AAGCCAAAAGAGCTGTAAACTGG - Intergenic
1021456664 7:20836353-20836375 AAGCTGATAATGCTGAAGACTGG + Intergenic
1022832611 7:34083670-34083692 AAGCCAATACACCTGAAGTCTGG - Intronic
1023621513 7:42077965-42077987 GAGCCAACACTGCTGAGGATTGG + Intronic
1023662521 7:42484860-42484882 AAGCCAAATTTGCAGAAGAATGG - Intergenic
1023678212 7:42653181-42653203 AAGCCAAAATAACTCAAGACTGG - Intergenic
1023914185 7:44576199-44576221 CAGCCAAACCTGTTGAAGGCTGG + Intergenic
1030413479 7:109212075-109212097 AACCAAAAAAAGCTGAAGACTGG - Intergenic
1030785082 7:113650193-113650215 AAGCCAACTTTGCTGAAGACAGG - Intergenic
1032665897 7:134035998-134036020 AAATCAAATCTGCTGAAGAGTGG - Intronic
1032985923 7:137337106-137337128 AAATCAGAACTGCTGAAGATGGG + Intronic
1033426928 7:141253105-141253127 GAGCCAAAACTGTGGAAGAGAGG - Intronic
1035916629 8:3631578-3631600 AAGCCAAATCGGTAGAAGACAGG + Intronic
1037201600 8:16260401-16260423 GAGTCAAAACTACGGAAGACTGG - Intronic
1037875934 8:22548443-22548465 AAGTCCAAACTGCTGGAAACGGG + Intronic
1042776580 8:72438902-72438924 AAGGCACAACTGCTGGAGAAAGG + Intergenic
1043331432 8:79122396-79122418 AAGTCCAAACTGCTGAAAAAGGG + Intergenic
1044147267 8:88732637-88732659 AAGCCCAAACTGACTAAGACAGG + Intergenic
1044483889 8:92726808-92726830 AAGCCAGAACTGCAGACGTCTGG + Intergenic
1044657214 8:94561213-94561235 AAACGAAAACTGCTGCAGATAGG - Intergenic
1046391750 8:113582283-113582305 AAGCCATAAATGCTGCAGACAGG + Intergenic
1048482392 8:134811283-134811305 AAACCATAAATGCTGAAGACTGG + Intergenic
1053393981 9:37755622-37755644 AAGCTAACACTCCTGAAGGCGGG - Intronic
1057064755 9:92038354-92038376 AATCCAGAAATGCTGAAGAAGGG + Exonic
1057464824 9:95303464-95303486 CAGCCTAAACTGACGAAGACAGG - Intronic
1058616211 9:106830699-106830721 AAGAGAACACTGCTGATGACCGG + Intergenic
1060660295 9:125401473-125401495 AAGCCCATACTGCTAATGACTGG - Intergenic
1203518062 Un_GL000213v1:22457-22479 AAGCTAAAACTCTTGAAAACAGG - Intergenic
1186188356 X:7043574-7043596 AATGCAAAACTGATTAAGACAGG + Intergenic
1187550885 X:20304451-20304473 AAGCCAAATTTGCTGCAGAGAGG - Intergenic
1189501266 X:41561338-41561360 AAGCCCACACTGCTAAAGACAGG + Intronic
1190908870 X:54754056-54754078 AAGCCTTAAATGCTGAACACAGG - Intronic
1191865939 X:65703933-65703955 ATGTTAAAACTGCTGAAGCCAGG - Intronic
1191995564 X:67091605-67091627 AAGCTAAACTTGCTGAAAACAGG - Intergenic
1196892247 X:120302539-120302561 AACCCAATTCTGCTGACGACTGG + Intronic