ID: 920041938

View in Genome Browser
Species Human (GRCh38)
Location 1:203103697-203103719
Sequence CAACCTCGTTGGGGGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920041929_920041938 24 Left 920041929 1:203103650-203103672 CCACTCACAGCAGAGGGGCTTCA 0: 1
1: 0
2: 3
3: 34
4: 230
Right 920041938 1:203103697-203103719 CAACCTCGTTGGGGGTTGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 100
920041930_920041938 -10 Left 920041930 1:203103684-203103706 CCAAGCAAATCCTCAACCTCGTT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 920041938 1:203103697-203103719 CAACCTCGTTGGGGGTTGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920041938 Original CRISPR CAACCTCGTTGGGGGTTGAG GGG Intronic
903449451 1:23442847-23442869 CAACCTCGTTGGGGCTAGTTGGG + Intronic
904910116 1:33928308-33928330 TAACCTCCTTGGGAGTTGTGAGG + Intronic
906199000 1:43947428-43947450 CCACCTCGTTTGGGGGTGGGAGG - Exonic
909060646 1:70875260-70875282 CAACCTCCCTGGGGTTTGACAGG + Intronic
909472244 1:76041537-76041559 CAACCTCCCTGGGAGTTGATAGG + Intergenic
910464540 1:87483693-87483715 AAATATAGTTGGGGGTTGAGAGG - Intergenic
914000982 1:143694052-143694074 CAAACTTGTTGGAGATTGAGGGG + Intergenic
914949992 1:152104850-152104872 GAACCTCTGTGGGGGTTGGGAGG + Intergenic
915570714 1:156743801-156743823 CAGCCACCTTGGAGGTTGAGAGG - Exonic
917561393 1:176160866-176160888 CACCTCCGTTGGGGGTGGAGGGG + Intronic
920041938 1:203103697-203103719 CAACCTCGTTGGGGGTTGAGGGG + Intronic
921350564 1:214230323-214230345 CATCCTCCTTGGGGGATGTGTGG + Intergenic
1064193859 10:13229798-13229820 TCACCTGGTTGGGGGATGAGTGG + Intronic
1064683529 10:17835594-17835616 GAACCTCCTTGGGGGAAGAGGGG - Intronic
1069709978 10:70481957-70481979 CTACCTCCTTGTGGGTTCAGTGG + Intronic
1074821082 10:117178991-117179013 AAACCTCATTGGGAGTTGGGGGG - Intergenic
1075765326 10:124888205-124888227 CAACTACCTGGGGGGTTGAGTGG + Intergenic
1075955146 10:126517093-126517115 GAACATCTTTGGGGGTGGAGGGG + Intronic
1083251727 11:61472343-61472365 CACCCTCCTTGAGGGTTGTGTGG + Intronic
1083430231 11:62610658-62610680 CAACATCCTTGGGGGTTAGGTGG - Intronic
1084216457 11:67649244-67649266 CAGCCTCTGTGGGGGTTGGGGGG - Intronic
1089770115 11:120796688-120796710 TCACCTTGTTGGGGGTGGAGGGG + Intronic
1092467943 12:8751013-8751035 CAGGCTTGGTGGGGGTTGAGGGG - Intronic
1092942649 12:13424731-13424753 CAACAGTGTTGGTGGTTGAGGGG + Intergenic
1101283200 12:103280967-103280989 CAACCTTGCTGGAGGGTGAGAGG + Intronic
1103821209 12:123700265-123700287 CAACATGGTTGGGGTTTAAGAGG - Intronic
1105855235 13:24366177-24366199 CTACTTGGTTGGGGGATGAGAGG - Intergenic
1112144293 13:96680291-96680313 CAACATCTTTTTGGGTTGAGTGG - Intronic
1113777758 13:112958489-112958511 CACCCTCGTCGGGGGCTGTGCGG - Intronic
1119302587 14:73583225-73583247 CCACCTACTTGGAGGTTGAGAGG + Intergenic
1119926474 14:78499029-78499051 CTACCTCATTGGAAGTTGAGAGG + Intronic
1122844118 14:104481458-104481480 CCACTTGGCTGGGGGTTGAGAGG - Intronic
1124701568 15:31917983-31918005 CTTCCTTGTTGGGTGTTGAGGGG + Intergenic
1124920680 15:34023218-34023240 CAACCTGAGTGGGGGATGAGAGG - Intronic
1130678741 15:85977972-85977994 AAACTTACTTGGGGGTTGAGGGG - Intergenic
1134622614 16:15700828-15700850 CCACCTGGTTGGGAGTTGGGGGG - Intronic
1136297999 16:29314570-29314592 CAACCTCGATGGGGGTCTGGAGG + Intergenic
1137323497 16:47410735-47410757 CAACGTCTATGGGGGTTGTGGGG - Intronic
1140517303 16:75552942-75552964 CAGCCTCCTTGAGGCTTGAGGGG + Intronic
1140959098 16:79895536-79895558 CAAAATCCTTGGGGGTTGTGGGG + Intergenic
1142059640 16:88021075-88021097 CAACCTCGATGGGGGTCTGGAGG + Intronic
1143877629 17:10004055-10004077 CAGCCTCGTAGGGTGTTTAGAGG + Intronic
1143962673 17:10733602-10733624 CAACCTCTTTGGGGCTTATGTGG + Intergenic
1145783132 17:27577267-27577289 CAGACTCGGTGGGGGGTGAGGGG - Intronic
1148748710 17:49932330-49932352 GAGCCTCGGTGGGGGTTGATAGG + Intergenic
1150575485 17:66426890-66426912 GAACTTCGTAGGTGGTTGAGTGG + Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1158188095 18:54794782-54794804 CAAACACATTGGGGGTTGGGGGG - Intronic
1161284701 19:3463302-3463324 CGTCCTCGGTGGGGGCTGAGGGG - Intronic
1162322843 19:9979960-9979982 CACCCTCATTGGGGGTTGGGTGG - Intronic
1162790034 19:13058000-13058022 CAAGCTCCTTGGGGCCTGAGGGG + Intronic
1163587449 19:18171845-18171867 CAGCCTTGTTGGGCCTTGAGAGG - Intronic
1163978358 19:20874335-20874357 TAACCACGTTGGGGAGTGAGTGG - Intergenic
1167810458 19:51825151-51825173 CCCCCTCTTTGGGGGTAGAGTGG + Exonic
1202647196 1_KI270706v1_random:153161-153183 TCACCTCGTGTGGGGTTGAGCGG + Intergenic
928668045 2:33570627-33570649 CTACCTCTTAGGGTGTTGAGAGG - Intergenic
944264712 2:197710542-197710564 CAACCACCTTGGGGGGTGGGGGG - Intronic
944680420 2:202072311-202072333 GAACTTGGTTGGGGGTGGAGGGG + Intergenic
945310234 2:208303574-208303596 CATCCTCGTTTCGTGTTGAGTGG + Intronic
945904790 2:215579376-215579398 AAGGCTCTTTGGGGGTTGAGTGG + Intergenic
946997993 2:225417916-225417938 CAATCTGGTAGGGGGTTGGGAGG + Intronic
1168980859 20:2002587-2002609 CCACCTCCATGGGTGTTGAGAGG - Intergenic
1168998357 20:2148880-2148902 CCACAGGGTTGGGGGTTGAGGGG - Intronic
1174362414 20:50037300-50037322 CTCCCTCGTTGGAGGTGGAGTGG - Intergenic
1176604672 21:8819613-8819635 TCACCTCGTGTGGGGTTGAGCGG - Intergenic
1180346962 22:11711218-11711240 TCACCTCGTGTGGGGTTGAGCGG - Intergenic
1180354708 22:11829308-11829330 TCACCTCGTGTGGGGTTGAGCGG - Intergenic
1180383544 22:12163024-12163046 TCACCTCGTGTGGGGTTGAGCGG + Intergenic
1184601342 22:45545326-45545348 CAACCCCATAGGGGGTTGTGAGG + Intronic
1185073504 22:48669999-48670021 CAAGCTGCTTGGGAGTTGAGGGG - Intronic
955828871 3:62980184-62980206 CAACATTTTTGGGGGCTGAGTGG - Intergenic
955967817 3:64407065-64407087 CAAGCTGGTTGGGGGGTGAGGGG - Intronic
956646773 3:71464508-71464530 CAGCCTCTTTGGGAGTTGACTGG + Intronic
957387465 3:79515464-79515486 AAACATTGTTGGTGGTTGAGAGG - Intronic
967356707 3:188579858-188579880 CACTCTCATTGGGGGTTGGGGGG + Intronic
969420675 4:7093265-7093287 CTACCTCGTTGGGGGAAGGGGGG + Intergenic
973373453 4:49271324-49271346 TCACCTCGTGTGGGGTTGAGCGG + Intergenic
973387559 4:49523884-49523906 TCACCTCGTGTGGGGTTGAGCGG - Intergenic
978062229 4:104352158-104352180 CAGCCTCTTTGGGGGTCTAGGGG - Intergenic
979222441 4:118243981-118244003 TAACCTGGTTGGGGGCTCAGTGG + Intronic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
1000197772 5:158976342-158976364 CAAGCTGGAGGGGGGTTGAGGGG - Intronic
1005426194 6:25705161-25705183 CAACATAGTTGGGGATTGGGCGG + Intergenic
1020111564 7:5450912-5450934 CAGCCTTGCTGGGGGCTGAGAGG - Intronic
1021190275 7:17612390-17612412 GATACTGGTTGGGGGTTGAGGGG + Intergenic
1024420674 7:49162079-49162101 TAACCATGTTGGGGGTTGACTGG + Intergenic
1025023585 7:55498335-55498357 CAGACACGTTGGGGGATGAGGGG - Intronic
1026396156 7:69956535-69956557 AAATCTCGTAAGGGGTTGAGGGG - Intronic
1032173490 7:129605437-129605459 CAAGCTCTTTGGGAGTTTAGAGG - Intergenic
1032915242 7:136482235-136482257 AAACCTAGTTGGGGGTAGAGTGG + Intergenic
1035787054 8:2269857-2269879 CGACCTCGTGGGGTGTTGGGAGG + Intergenic
1035787092 8:2270031-2270053 CGACCTCGTGGGGTGTTGGGAGG + Intergenic
1035805715 8:2451685-2451707 CGACCTCGTGGGGTGTTGGGAGG - Intergenic
1035805753 8:2451859-2451881 CGACCTCGTGGGGTGTTGGGAGG - Intergenic
1044711452 8:95062300-95062322 CAACCTCAGTGGTGGTTGTGAGG + Intronic
1057962575 9:99470761-99470783 AAACCTAGGTGGGGGTTTAGTGG + Intergenic
1058657106 9:107232867-107232889 CTGCCTCCTTGGTGGTTGAGTGG - Intergenic
1061086878 9:128404757-128404779 CAACCCCGAGGGGGGTTGGGTGG + Intergenic
1061382676 9:130267814-130267836 CAACCAAGCTGGGGGTTGTGAGG + Intergenic
1203697164 Un_GL000214v1:109327-109349 TCACCTCGTGTGGGGTTGAGCGG + Intergenic
1187391568 X:18889676-18889698 CAGCCTGGTTGGGGGGTGGGAGG - Intergenic
1190416413 X:50184503-50184525 GCTCCTTGTTGGGGGTTGAGGGG - Intergenic
1192865223 X:75124130-75124152 CAAAATCCTTGGAGGTTGAGGGG - Intronic
1194938023 X:99974673-99974695 AAAGCCTGTTGGGGGTTGAGAGG - Intergenic