ID: 920043014

View in Genome Browser
Species Human (GRCh38)
Location 1:203116156-203116178
Sequence CCTGGCAGGTGGAAGTTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 616}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920042995_920043014 21 Left 920042995 1:203116112-203116134 CCCCCCAAATCAGGCATCATCCC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920043001_920043014 0 Left 920043001 1:203116133-203116155 CCAGCCAGTCCTTCCCGCCCTCT 0: 1
1: 0
2: 3
3: 50
4: 445
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920042996_920043014 20 Left 920042996 1:203116113-203116135 CCCCCAAATCAGGCATCATCCCA 0: 1
1: 0
2: 2
3: 10
4: 155
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920042999_920043014 17 Left 920042999 1:203116116-203116138 CCAAATCAGGCATCATCCCAGCC 0: 1
1: 0
2: 0
3: 12
4: 235
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920043004_920043014 -9 Left 920043004 1:203116142-203116164 CCTTCCCGCCCTCTCCTGGCAGG 0: 1
1: 0
2: 3
3: 36
4: 478
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920043002_920043014 -4 Left 920043002 1:203116137-203116159 CCAGTCCTTCCCGCCCTCTCCTG 0: 1
1: 0
2: 1
3: 71
4: 744
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920043000_920043014 1 Left 920043000 1:203116132-203116154 CCCAGCCAGTCCTTCCCGCCCTC 0: 1
1: 0
2: 2
3: 40
4: 352
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920042998_920043014 18 Left 920042998 1:203116115-203116137 CCCAAATCAGGCATCATCCCAGC 0: 1
1: 0
2: 1
3: 12
4: 146
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616
920042997_920043014 19 Left 920042997 1:203116114-203116136 CCCCAAATCAGGCATCATCCCAG 0: 1
1: 0
2: 2
3: 17
4: 140
Right 920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 65
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920043014 Original CRISPR CCTGGCAGGTGGAAGTTGGC GGG Intronic
900159504 1:1216756-1216778 CCTGGCAGGTGGCAACGGGCAGG - Intergenic
900399073 1:2465587-2465609 CCCGGCGGGTGGCAGGTGGCGGG - Intronic
900765010 1:4499081-4499103 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
901260353 1:7866247-7866269 CCTCGCAGCTGAAAGTAGGCAGG + Intergenic
901433467 1:9232564-9232586 CCTGGGAGGTGGAGGTTGCGGGG - Intergenic
901534989 1:9876539-9876561 CCTGGGAGGCGGCAGTTGCCTGG + Intronic
901793536 1:11667275-11667297 CCAGGTAGGTGGGGGTTGGCCGG - Intronic
901807007 1:11744928-11744950 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
902258725 1:15207717-15207739 CTTTGCAGGTGGAAGTCAGCAGG - Intronic
902701331 1:18174584-18174606 GCTGGCAGGGGGAAGTCGGGTGG - Intronic
902919681 1:19658320-19658342 CCAGGCAGGAGGCAGTGGGCTGG - Intronic
903151010 1:21408735-21408757 CCTGGGAGGTCGAGGTTGCCTGG + Intergenic
903268881 1:22175481-22175503 GCTGGCAAGAGGCAGTTGGCAGG + Intergenic
903586003 1:24415718-24415740 CCTGCCAGTCAGAAGTTGGCAGG - Intronic
904409886 1:30319072-30319094 CCTGGGAGGAGGAAGCTGGGTGG + Intergenic
904465573 1:30705329-30705351 CGTGGGAGGAGGAAGATGGCAGG + Intergenic
905669607 1:39782867-39782889 CCTGGGAGATGGAGGTTGCCTGG - Intronic
906210407 1:44009710-44009732 CTTGGTAGGGGTAAGTTGGCGGG + Intronic
906445932 1:45898031-45898053 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
906706728 1:47900359-47900381 CCTGGCAGGTGGCACTTGCTCGG - Intronic
906905734 1:49889679-49889701 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
909163489 1:72185090-72185112 CCTGGCACCTGGAACATGGCAGG + Intronic
909578729 1:77207089-77207111 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
910114822 1:83720461-83720483 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
911055976 1:93708850-93708872 ACAGGCAGGAGGAGGTTGGCAGG + Intronic
912368537 1:109154659-109154681 CCTGGCAGGAAGAAGAAGGCTGG + Intronic
912953078 1:114133996-114134018 CCTGGCAGGTGGCACCAGGCAGG - Intronic
913003796 1:114608182-114608204 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
914696182 1:150082428-150082450 CCTGGGAGGCGGAGGTTGGGAGG + Intronic
914743104 1:150481598-150481620 CCTGGGAGGTGGAGGTTGCAAGG - Intergenic
915254952 1:154620328-154620350 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
915314571 1:155021073-155021095 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
915470977 1:156125611-156125633 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
915520884 1:156442886-156442908 CCTGGGAGGCGGAAGTTGCAGGG - Intergenic
916569200 1:166010006-166010028 ACTGGCAGTGGGAAGTTGACTGG - Intergenic
917574385 1:176305561-176305583 ACTGGGAGCTGGCAGTTGGCAGG + Intergenic
917618122 1:176767421-176767443 CCCGGGAGGTGGAGGTTGGGAGG - Intronic
918038268 1:180896334-180896356 CCTGGCTGGCTGAAGTTGGTGGG - Intergenic
919990978 1:202708765-202708787 AGTGGCAGGTGGAAGGGGGCAGG - Intronic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
920279949 1:204835302-204835324 CCTGGGAGGTGGAGGTTGCAAGG - Intronic
920527533 1:206678603-206678625 CCTGGCAGGTGTCAGCTAGCTGG + Intronic
920776138 1:208938994-208939016 CCAGGCATCTGGAAGATGGCGGG + Intergenic
921392350 1:214629625-214629647 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
922053878 1:222021883-222021905 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
922490382 1:226011786-226011808 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
922679743 1:227583425-227583447 CCTGGGAGGTGGACGTTGCAGGG - Intronic
923078517 1:230631883-230631905 CATGGCAGGTGGAGGTTTACAGG + Intergenic
923752452 1:236758693-236758715 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
924497680 1:244606217-244606239 CCTGGCGGGTGGAAGGAAGCCGG - Intronic
924691153 1:246352059-246352081 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
924719993 1:246613767-246613789 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1062883007 10:993833-993855 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1063404993 10:5785448-5785470 CCTGGGAGGTGGAAGTTGTGGGG - Intronic
1063739633 10:8803985-8804007 CCTGGAAGGTGGCATGTGGCTGG + Intergenic
1064001553 10:11667662-11667684 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1066086823 10:31979322-31979344 CCTGGCAGGAGGGAGGTGGGGGG - Intergenic
1066288777 10:33994377-33994399 CCTGGGAGGTTGAAGTTGCAGGG + Intergenic
1066448006 10:35501428-35501450 CCTGGCAGGTGGATGAGGACTGG - Intronic
1067842479 10:49691900-49691922 CCTCACAGGTGGAGGTTGGGGGG + Intronic
1068729410 10:60339701-60339723 CCTGGGAGGAGAAAGTTGTCTGG - Intronic
1068848133 10:61704146-61704168 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1069435162 10:68374866-68374888 GCTGGCAGGTTGAGGTTGACAGG - Intronic
1069444332 10:68458770-68458792 CCTGGGAGGCGGAGGTTGCCGGG + Intronic
1069615339 10:69802979-69803001 CCGGGCAGGTGGAGGAAGGCTGG + Intronic
1069665367 10:70152232-70152254 CCTGGGACTTGGAAGCTGGCAGG - Exonic
1069985841 10:72282685-72282707 CCCGGTAGGTGGAAGTTGTAGGG + Intergenic
1070077806 10:73155139-73155161 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1071023607 10:81086264-81086286 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1071381162 10:85061550-85061572 CCTGGCAGATGGGAGATGGATGG - Intergenic
1071790515 10:88949010-88949032 CCTTGGAGGTGGGAGTTGTCAGG - Intronic
1072493101 10:95928133-95928155 ACTGGGAGGTGGAAGTAGGAAGG - Intronic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1074468756 10:113707825-113707847 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1075031542 10:119027920-119027942 CCTGGCAGGTGGGCCCTGGCAGG - Intergenic
1075380083 10:122012011-122012033 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1075439978 10:122472469-122472491 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1076208066 10:128618975-128618997 CCAGGCAGATGGAAGGAGGCAGG + Intergenic
1077329506 11:1977843-1977865 CCTGGCAGATGGGAGATGGCAGG - Intronic
1077461265 11:2711900-2711922 CATGGCAGGTGGCAGGTGGCTGG + Intronic
1077521673 11:3039454-3039476 CTTGGCAGGTGGGAGATGGAGGG - Intronic
1078281971 11:9911289-9911311 CCTGGGAGGTGGAAGTTTCAAGG + Intronic
1078517147 11:12032262-12032284 CCTGGTAGCTGGAGGTTGGTGGG + Intergenic
1078790547 11:14537782-14537804 CCTGGGAGATGGAAGTTGCAGGG - Intronic
1081291709 11:41334482-41334504 CCTGGCAGGTGTTAGATGTCTGG + Intronic
1081906927 11:46676077-46676099 CCTGGCAGGTGGAAATGGCCTGG + Intergenic
1082623117 11:55448653-55448675 GCTGGCAGAGGGATGTTGGCTGG + Intergenic
1082625675 11:55481848-55481870 GCTGGCAGAGGGATGTTGGCTGG + Intergenic
1082861176 11:57858040-57858062 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1082907971 11:58333594-58333616 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1083113255 11:60432707-60432729 CCTGGGAGGTGGAGGTTGCAAGG + Intronic
1083162455 11:60863266-60863288 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1083428107 11:62599728-62599750 CCTGGAAGTTAGAAGATGGCTGG - Intronic
1083607760 11:63988936-63988958 CCTGGGAGGTGGAGGTTGTAGGG + Intronic
1084219210 11:67667322-67667344 CCTGGCATGTGGAGTGTGGCAGG - Intronic
1084328893 11:68418324-68418346 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1084544623 11:69808663-69808685 CCTGGCAAGGGGAACTTGCCCGG - Intergenic
1084836152 11:71803300-71803322 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1084844623 11:71889337-71889359 CCAGCCAGGTGGAAGCTCGCTGG - Intronic
1085091290 11:73716444-73716466 CCTGGAAGTTGGAAGGGGGCTGG + Intronic
1085301884 11:75463432-75463454 CCAGCCAGGTGGAAGTGGGGTGG + Intronic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1085514121 11:77102582-77102604 GCAGGCAGGCGGAAGGTGGCAGG - Intronic
1087076592 11:94131567-94131589 CCAGGCTGGTGAAGGTTGGCAGG + Intronic
1087355998 11:97095348-97095370 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1087983826 11:104651772-104651794 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1088026152 11:105186093-105186115 CCTGGGAGATGGAGGTTGCCTGG - Intergenic
1088475949 11:110239795-110239817 CCCGGGAGGTGGAGGTTGCCTGG + Intronic
1088933738 11:114378077-114378099 CCTGGTAGGAGGGAGCTGGCTGG + Intergenic
1090271175 11:125387421-125387443 CCTGGCAGGTGGTGGTGGGCAGG - Intronic
1090846708 11:130535657-130535679 CCTGTTAGGTGGCAGTTGGCTGG - Intergenic
1202812485 11_KI270721v1_random:33022-33044 CCTGGCAGATGGGAGATGGCAGG - Intergenic
1091962537 12:4709907-4709929 GCTGGCAGGTGGCAGCTGGTAGG + Intronic
1092883091 12:12902989-12903011 CCTGGGAGGTGGAGGTTGCCGGG + Intronic
1093610450 12:21149583-21149605 CCTGGGAAGTGCAAGTTGTCAGG + Intronic
1093743827 12:22717567-22717589 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1094559960 12:31542878-31542900 CCTGGGAGGTGGAAGTTGCAGGG + Intronic
1094583551 12:31756429-31756451 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1095152409 12:38811049-38811071 CATGGCAGGAGGAAGTTTACAGG - Intronic
1096188632 12:49600182-49600204 CCTGGGAGGAGGAATTCGGCCGG - Exonic
1096411182 12:51378228-51378250 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1096707984 12:53434720-53434742 CCTGGGAGGTGGAGGTTGTAGGG + Intergenic
1096981579 12:55730583-55730605 CATGGCAGGTTGGGGTTGGCTGG + Intergenic
1097120738 12:56729647-56729669 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1097286396 12:57880458-57880480 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1097801943 12:63924063-63924085 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1097982824 12:65751761-65751783 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1098087860 12:66867062-66867084 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1098542356 12:71670861-71670883 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1099192054 12:79570785-79570807 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1100995699 12:100298657-100298679 CCTGGGAGGTGGAAGTTGCAGGG - Intronic
1101398457 12:104368076-104368098 GCTGGCAGGTGGAAGATGGTGGG + Intergenic
1101933559 12:109036374-109036396 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1102270084 12:111526478-111526500 CCTGGAAGGTGGATGTTGCAGGG - Intronic
1102725518 12:115061048-115061070 CCTGGAAGGTGGGAGTTGAGAGG + Intergenic
1102859541 12:116323419-116323441 CCTGGCAGGTGGAGGTTACAGGG + Intergenic
1104720240 12:131041321-131041343 CCTGGAAGGAGGAAGTTGTCTGG + Intronic
1104969878 12:132526495-132526517 TCTGGCAGCTGGGAGCTGGCGGG + Intronic
1105210538 13:18254385-18254407 CCTGGCTGGATGAAATTGGCAGG + Intergenic
1105411459 13:20174777-20174799 CCTGGCGTCTGGAAGGTGGCTGG + Intergenic
1105805970 13:23951731-23951753 CATGGCAGCTGGATGGTGGCTGG + Intergenic
1105907132 13:24823147-24823169 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1106331096 13:28740392-28740414 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1107541471 13:41393260-41393282 GCTGGCAGCTGGAAATTGGCCGG - Intergenic
1108374976 13:49805499-49805521 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1108931892 13:55835337-55835359 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1109388424 13:61664125-61664147 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1112283058 13:98079751-98079773 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1112560391 13:100507730-100507752 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1112792178 13:103015353-103015375 CCTTGCAGGTGGCAGATGGTGGG - Intergenic
1113439230 13:110314841-110314863 ACGGGCAGGTGGCAGGTGGCTGG + Intronic
1114505608 14:23210073-23210095 CCTGGAAGGTGGAGGTTGCAGGG + Intronic
1114654373 14:24307385-24307407 CCTGGCGGGTGGCAGCTGTCAGG + Exonic
1115625248 14:35185551-35185573 ATTGGCAGGTGGAAGTTTGCAGG - Intronic
1116313624 14:43359406-43359428 CCTGGAAGGTTGCACTTGGCAGG + Intergenic
1116721113 14:48496667-48496689 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1117144360 14:52822172-52822194 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1117145140 14:52829934-52829956 CCTGGGAGGCGGAATTTGTCAGG + Intergenic
1117740852 14:58817492-58817514 CCTGGGAGGTGGAGGTTGCAAGG + Intergenic
1118717861 14:68573096-68573118 CCTGGCTGCTGGGAGTTGACTGG - Intronic
1119043695 14:71298324-71298346 CTTGGCAGGTGGAAGGTGTCTGG - Intergenic
1119294309 14:73520784-73520806 CCAGGAAGGTGGAAGATTGCTGG - Intronic
1119474054 14:74917046-74917068 CGTGGCAGATGGAAGCTGGCAGG + Intronic
1120485599 14:85109779-85109801 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1120968103 14:90185155-90185177 CCTGGAAGGTGGCTGTTGGTTGG - Exonic
1121504659 14:94467727-94467749 CCTGGCAGATGGAGGGTGGATGG + Intronic
1121546224 14:94765632-94765654 CGGGGCAGGTGCAAGGTGGCAGG - Intergenic
1121640131 14:95479768-95479790 CCTGGCTTGAGGAAGGTGGCTGG + Intergenic
1121686977 14:95842920-95842942 CCTGGGAGGTGGAGGTTGCATGG + Intergenic
1121689243 14:95864100-95864122 CCAGGGAGGTGGAAATTGGCAGG + Intergenic
1122286615 14:100656064-100656086 CTGGGCAGCTGGATGTTGGCTGG + Intergenic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122555735 14:102578871-102578893 CCTGGGAGGTCGAGGTTGCCAGG + Intergenic
1122789730 14:104179138-104179160 CCTGGCAGGTGAAGGGAGGCGGG + Intronic
1123021742 14:105401113-105401135 CCTGGCAGGCGGAAGTGTGCAGG - Intronic
1123451010 15:20358646-20358668 CCTGGCAGCTGGCACGTGGCTGG + Intergenic
1123861094 15:24467500-24467522 CCTGGGAGGTGGAGGTTGCAAGG - Intergenic
1124682458 15:31746570-31746592 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1125845936 15:42853803-42853825 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1126663477 15:51054570-51054592 CATGGCAGGTGGCAGCTGGCAGG + Intergenic
1127500423 15:59549420-59549442 CCTGGAGGGTGGAAGTTACCTGG + Intergenic
1127527787 15:59810944-59810966 CCTGGGAGGTAGAAGTTGCAGGG + Intergenic
1127788146 15:62374215-62374237 CCTGGGAGGCGGAAGTTGCAGGG + Intergenic
1127939772 15:63683058-63683080 ACTGGCAGGTGGAGGTTGCAGGG + Intronic
1127965675 15:63921163-63921185 CCGGGCATCTGGAAGTTGGTTGG + Intronic
1128080588 15:64854737-64854759 CCTGGCAAGTGCATGCTGGCTGG - Intronic
1128130800 15:65225931-65225953 CCTGGGAGGTGGAAGTTGTAGGG - Intergenic
1128151051 15:65363652-65363674 CCTGGCAGGAGGCGGGTGGCGGG - Intronic
1128514807 15:68335553-68335575 CCTGGCAGCATGAAGGTGGCTGG + Intronic
1129199153 15:73988537-73988559 CCTGGCAGGTGGAGCCAGGCCGG + Intronic
1129420770 15:75424356-75424378 CCAGGGAGGTGGAAGTTGCGGGG + Intronic
1129520444 15:76182742-76182764 CTTTGCTGGTGAAAGTTGGCAGG + Intronic
1129791433 15:78343037-78343059 CCTGGGAGGTGGAGGTTGTAAGG + Intronic
1130543959 15:84841095-84841117 CCTGGCATCTGGAAACTGGCTGG - Intronic
1130550810 15:84888935-84888957 CCTGGCGGATGGGAGTTGGGGGG + Intronic
1130562000 15:84966151-84966173 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1130679498 15:85983963-85983985 CCTGGAAGGTGGAGGTTGTAGGG + Intergenic
1131158148 15:90087626-90087648 CCTGGGAGGTGGGAGGTTGCCGG - Intronic
1131246393 15:90797338-90797360 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1131747094 15:95460511-95460533 CCTGTCTGGTGGAAGATGGAAGG + Intergenic
1132003861 15:98208230-98208252 CCTGCCAGGTGTCAGCTGGCCGG - Intergenic
1132116239 15:99138387-99138409 CCTGGGAGGCGGAAGTTGCAGGG - Intronic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1133284403 16:4683911-4683933 CCTGGCAGGTAGATGTCAGCAGG - Exonic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1133880602 16:9777987-9778009 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1134174674 16:11995982-11996004 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1135334120 16:21586527-21586549 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1135757963 16:25113709-25113731 CCCGGCAGGTGGAAGTTACCAGG - Intronic
1136052884 16:27665674-27665696 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1138057123 16:53846724-53846746 CCCGGGAGGTGGAAGTTGCAGGG + Intronic
1138441074 16:57035318-57035340 TCTGCCAGGTGGAAGTGGCCAGG - Intronic
1139124452 16:64061362-64061384 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1139438484 16:66950495-66950517 CCAGGCAGGTGGGAGCTGGTGGG + Intergenic
1139708004 16:68755198-68755220 CCTGGGAGGTTGAAGCTGCCTGG + Intronic
1140135216 16:72199576-72199598 CCTGGGAGGTGGAAGTTGCAGGG + Intergenic
1141745422 16:85922827-85922849 CCTGGGAGGTGGAAGTTGCAGGG - Intergenic
1143139149 17:4731099-4731121 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1143229056 17:5335594-5335616 GGTGGCAGAGGGAAGTTGGCAGG - Intronic
1143563149 17:7706945-7706967 CATTGCAGCTGGGAGTTGGCAGG - Intronic
1143878519 17:10011898-10011920 CCTGGGAGGTGGAGGTTGTGTGG + Intronic
1144054323 17:11525555-11525577 CCCGGGAGGTGGAAGTTGCAGGG + Intronic
1144624149 17:16836209-16836231 CCTGGAATGGGGAACTTGGCGGG - Intergenic
1144882277 17:18436510-18436532 CCTGGAATGGGGAACTTGGCGGG + Intergenic
1145149957 17:20507876-20507898 CCTGGAATGGGGAACTTGGCGGG - Intergenic
1145317867 17:21745582-21745604 CCTGGCAGGTGGAAGGCTGTGGG - Intergenic
1145892486 17:28426913-28426935 CATGGCAGGTGGTGGCTGGCTGG - Intergenic
1145933145 17:28700229-28700251 CCTGCAAGGTTGATGTTGGCTGG - Exonic
1146161886 17:30564514-30564536 CCTGGAATGGGGAACTTGGCGGG - Intergenic
1146403243 17:32516889-32516911 CCTGGCTGGTGTAAATGGGCTGG + Intronic
1146996938 17:37329342-37329364 CCTAGCAGGTAGAAGTGGCCAGG + Intronic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147418262 17:40309101-40309123 GCTGGCTGGTGGAAGAGGGCGGG + Intergenic
1147505493 17:41012596-41012618 GGTGGCAGGTGGCAGGTGGCAGG + Intronic
1147739662 17:42663865-42663887 CCTGGGAGGTGGAGGTTGCAAGG + Intronic
1147843918 17:43391693-43391715 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1148175818 17:45563757-45563779 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1148295554 17:46499234-46499256 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1148411486 17:47471216-47471238 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1148465229 17:47861023-47861045 CCTGGCAGGCGGAATCAGGCGGG + Intergenic
1148538666 17:48462253-48462275 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1148564329 17:48624503-48624525 CCTGGCAGGTTGGAGGTGACAGG + Intronic
1148752723 17:49954764-49954786 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1148807698 17:50272536-50272558 CCCTGCAGGTGGACCTTGGCAGG - Intronic
1148932538 17:51138666-51138688 CCTGGGAGGTGGAAATTGTAGGG + Intergenic
1149138476 17:53399846-53399868 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1150303959 17:64068693-64068715 GCTGGCAGGTGGAGGCTGGGAGG + Intronic
1150378266 17:64700370-64700392 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1150407043 17:64910718-64910740 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1150465998 17:65393045-65393067 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1151715940 17:75831097-75831119 CCTGGAAGGTGGCAGTGTGCAGG + Exonic
1151765839 17:76132743-76132765 CCCGGCAGGGGGCAGTGGGCTGG - Intergenic
1152245989 17:79184794-79184816 CCTGGCAGTGGGGAGATGGCTGG + Intronic
1152337436 17:79706699-79706721 CCTGGCAGCTGGCACGTGGCTGG - Intergenic
1152523272 17:80872794-80872816 CCTGGCAGGTGGAGGTAGCACGG + Intronic
1152601196 17:81263124-81263146 CCTGGGAGGTGGCAGGTGGTGGG - Intronic
1152602955 17:81274306-81274328 CGTGGCTGGTGGAAGTCTGCAGG + Intronic
1152763949 17:82125449-82125471 CCTGGGAGGTGGAGGTTGTAGGG - Intronic
1153256703 18:3178941-3178963 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1153336668 18:3932225-3932247 CCTGGCAGCTTGAGGTTGGTAGG + Intronic
1153808782 18:8733768-8733790 CCTCGCAGGTGGGAGTGGGCCGG + Intronic
1156356816 18:36349145-36349167 CGTGACATGTGGCAGTTGGCAGG + Intronic
1156595519 18:38543726-38543748 CCTGGAAGGTGGAGGTTGCAGGG - Intergenic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157384073 18:47247537-47247559 CCCGGCAGGAGGAGGTGGGCCGG + Intronic
1157541872 18:48516389-48516411 TCTGGAGGCTGGAAGTTGGCAGG - Intergenic
1157559113 18:48633624-48633646 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1158966005 18:62622772-62622794 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1160695573 19:482784-482806 ACTGGCAGGTGTAGGTGGGCAGG - Intergenic
1160772770 19:840527-840549 ACTGGCAGGAGGATGTTCGCTGG + Intergenic
1161181973 19:2889718-2889740 CCTGAGAGGTGGAAGTTGCAGGG - Intergenic
1161379961 19:3959685-3959707 ACTGGCAGGTGGGGGCTGGCGGG - Intronic
1161464389 19:4420316-4420338 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG + Exonic
1161742622 19:6032613-6032635 CCTGCCAAGTGGGAGTTGGGAGG - Intronic
1161946882 19:7442963-7442985 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1161971708 19:7585237-7585259 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162500087 19:11048305-11048327 CCTGGAAGGTGGAGGTTGCAGGG - Intronic
1162535764 19:11262255-11262277 CCCGGCCGGAGGAAGCTGGCGGG + Intronic
1163285915 19:16347563-16347585 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1163381258 19:16970507-16970529 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1163605937 19:18275234-18275256 CATGGCAGATGGCAGTTGGGTGG + Intergenic
1163634386 19:18431501-18431523 CCTGGCTGGTGCCAGCTGGCCGG + Intronic
1163788649 19:19292195-19292217 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1165227049 19:34362209-34362231 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1165228026 19:34367747-34367769 CCTGGCAGTTGGTAGTTATCGGG + Intronic
1165553944 19:36613514-36613536 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1165580513 19:36858688-36858710 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1165613836 19:37180856-37180878 CCTGGGAGGTGGAGGTTGTGGGG + Intronic
1166645720 19:44530351-44530373 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1166679601 19:44758753-44758775 GCTGGGAGGTGGAAGCAGGCCGG - Exonic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166882184 19:45936297-45936319 CTTGGCTGGTGGAATTTGGGGGG + Exonic
1166956479 19:46468829-46468851 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1168544251 19:57237277-57237299 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
925348453 2:3186079-3186101 CCTGGCAGCTGGTGGATGGCAGG - Intergenic
925564227 2:5232426-5232448 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
925586993 2:5474699-5474721 CGAGGCAGGTGGATGTGGGCGGG - Intergenic
925587035 2:5474829-5474851 CGAGGCAGGTGGATGTGGGCGGG - Intergenic
925977738 2:9152724-9152746 CCTGGGAGGTGGAAGTTGCAGGG + Intergenic
926727941 2:16013160-16013182 CCTCGGAGGTGGCAGATGGCAGG - Intergenic
927532702 2:23823092-23823114 CCTGGCATATGGTAGTTGCCTGG - Intronic
927589559 2:24341776-24341798 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
928628074 2:33161341-33161363 CCTGGGAGGTGGAGGTTGGGAGG - Intronic
928661586 2:33507599-33507621 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG + Intergenic
929510600 2:42563242-42563264 CCTGGGAGGTGGAGGTTGTAGGG - Intronic
929847035 2:45541261-45541283 CCTGGAAGGTGGGAGATGCCAGG + Intronic
931649215 2:64453914-64453936 CGTGGCAGGAGGAAGGAGGCTGG + Intergenic
931752615 2:65344059-65344081 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
932389834 2:71377187-71377209 CCTGGGAGGCGGAGGTTGGCTGG + Intronic
932457374 2:71858182-71858204 CCTGGAAGGTGGGAGGTGGAGGG - Intergenic
932620201 2:73260623-73260645 CCTGGGTGGTGGCAGGTGGCAGG - Intronic
932637667 2:73406699-73406721 CCCGGGAGGTGGAGGTTGGGGGG - Intronic
933356627 2:81218319-81218341 CCTGGCAGCAGGAAGGTGGCGGG - Intergenic
933489202 2:82963786-82963808 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
933745740 2:85569749-85569771 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
934753769 2:96811005-96811027 CCTGGCAGGTGAAACTCTGCAGG + Exonic
934999586 2:99000432-99000454 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
935100635 2:99991825-99991847 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
935130541 2:100257933-100257955 CCTGGCATCTGGAAGGTGGAGGG - Intergenic
935193983 2:100800645-100800667 CCTGGCTCTTGGAAGGTGGCAGG - Intergenic
935253150 2:101283154-101283176 GCTGCCAGGTAGAAGTTGGAAGG - Intronic
935758394 2:106296193-106296215 CCTGGGAGGTGGAGATTGGGAGG + Intergenic
936600324 2:113889406-113889428 CCTGGGAGGTGGGGGTTGGGGGG + Intergenic
937036211 2:118784757-118784779 ACTGCCAGGTGGCAGCTGGCAGG + Intergenic
937040170 2:118814706-118814728 CCTGGCAAGAGGATGTTGGAGGG + Intergenic
937142137 2:119611075-119611097 CCTGGGTGGTGGAAGCTGACAGG - Intronic
938569841 2:132552999-132553021 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
939372098 2:141314547-141314569 TCTGGGAGGTGGAGGTGGGCGGG + Intronic
940354875 2:152729291-152729313 CCTGGGAGGTGGAGGTTGCCTGG + Intronic
941396652 2:164982058-164982080 CCTGGGAGATTGAAGATGGCAGG - Intergenic
941426805 2:165356959-165356981 CCTGCCAGGTGGAAGCAGACAGG + Intronic
941956773 2:171213308-171213330 CCTGGCAGGCTGAGGTTGGGAGG - Intronic
942705162 2:178763244-178763266 CCTGGGATGAGGAAATTGGCTGG + Intronic
942950711 2:181717867-181717889 ACTGGCAGTTGGAAAGTGGCTGG + Intergenic
943062870 2:183056874-183056896 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
943236324 2:185325245-185325267 CCTGGAAGGTGGACGTTGTAGGG - Intergenic
943653411 2:190481584-190481606 TCTGGCAGGTGAAAGGGGGCAGG - Intronic
943738603 2:191386115-191386137 CCTTGCAGGGGTAACTTGGCAGG - Intronic
944131316 2:196350287-196350309 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
944218187 2:197276197-197276219 CCTGGGAGGTAGAAGTTGCAGGG + Intronic
944232820 2:197412899-197412921 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
944665445 2:201955453-201955475 CCAGGCAGGTGGAAGAAGACAGG + Intergenic
944814342 2:203360107-203360129 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
945094445 2:206205773-206205795 CCTGGGAGGTGGAGGTTGCGGGG - Intronic
947170455 2:227305591-227305613 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
947543084 2:230991768-230991790 CCTGGCAGGGTGGAGCTGGCAGG - Intergenic
947822200 2:233080003-233080025 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
947836303 2:233178556-233178578 CCTGGCAGGCGGAGGTTGCAGGG - Intronic
948150168 2:235738631-235738653 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
948456982 2:238109122-238109144 CCTGACAGGTGGCTGGTGGCAGG + Intronic
948499059 2:238378347-238378369 CATGGCAGGTGCCAGATGGCTGG - Intronic
948556728 2:238816808-238816830 TATGGCAAGTGGACGTTGGCAGG + Intergenic
948982284 2:241500535-241500557 CCTGGCCTGTGGGAGTGGGCGGG - Intronic
949043673 2:241860611-241860633 CCTGGCAGGTGGAATTTTGGGGG - Intergenic
1168813426 20:720940-720962 CCTGGCATGTGGTAGATGCCTGG - Intergenic
1169483271 20:6004898-6004920 CCTGGCAAGAGGGAGTGGGCAGG - Intergenic
1169815479 20:9651702-9651724 CCTGGGAGGAAGTAGTTGGCAGG + Intronic
1169870635 20:10244804-10244826 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1170812418 20:19684918-19684940 CCTCCCAGATGGAAGTTGTCTGG + Intronic
1171035658 20:21710572-21710594 AGTGGCAGGTGGCAGTGGGCAGG + Intronic
1171291679 20:23986075-23986097 CCTGGCTGGATGAAATTGGCAGG + Exonic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171841883 20:30223901-30223923 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1171868610 20:30508634-30508656 CCTGGAAGGTGGCAGGTAGCCGG + Intergenic
1172261145 20:33566528-33566550 CCTGGGAGGCGGAAGTTGCAGGG + Intronic
1172287302 20:33749826-33749848 CCTGGGAGGTGGAAGTTGCAGGG - Intronic
1172667017 20:36607302-36607324 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1172729337 20:37072390-37072412 CCCGGGAGGTGGAAGTTGCGGGG + Intronic
1172851800 20:37971747-37971769 CAGGGCAGCTGGAAGTTGGCTGG + Intergenic
1173017737 20:39241065-39241087 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1173803042 20:45906813-45906835 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1173814525 20:45976649-45976671 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1174246461 20:49185915-49185937 CCCGGGAGGTGGAGGTTGCCTGG - Intronic
1174280992 20:49439186-49439208 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1174444663 20:50582587-50582609 CCTCGGAGGTTGAAGTTGCCGGG + Intronic
1174516196 20:51094194-51094216 CCTGGTAGGTGGAGGTTGCAGGG + Intergenic
1175132889 20:56802870-56802892 CCCGGGAGGTGGACGTTGTCAGG - Intergenic
1175272740 20:57746415-57746437 CCTGTGAGGTGGTGGTTGGCAGG - Intergenic
1175324136 20:58110805-58110827 CCAGGGAGGTGGAGGTTGGAGGG - Intergenic
1176224998 20:63992335-63992357 CCTGGGAGGTGGAAGTTGCAGGG - Intronic
1176551381 21:8223969-8223991 CCTGGAAGGTGGCAGGTAGCCGG - Intergenic
1176570290 21:8406968-8406990 CCTGGAAGGTGGCAGGTAGCCGG - Intergenic
1176578199 21:8451155-8451177 CCTGGAAGGTGGCAGGTAGCCGG - Intergenic
1177493392 21:21857249-21857271 ATTGGCAGGTGGAAGGTGGGAGG + Intergenic
1177741957 21:25165499-25165521 ACTTGCAGGTGGAAGCTGGGAGG + Intergenic
1177983058 21:27938890-27938912 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1178250769 21:31001220-31001242 CCTGGGAGGTAGAAGTTGCAGGG + Intergenic
1178275123 21:31230053-31230075 CCTGGCAGGTGGAAGCTCAGGGG + Intronic
1178333432 21:31721800-31721822 CCTGGGAGGTGGAGGTTGCGAGG - Intronic
1178861270 21:36291482-36291504 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1179768910 21:43598278-43598300 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1179928555 21:44551789-44551811 CCTGCCAGGTGGAAGTCACCAGG - Intronic
1179940605 21:44637077-44637099 CCTGCCAGGTGGAAGTCACCAGG + Intronic
1179970492 21:44834577-44834599 CCTGGCAGGTGAAATAAGGCTGG + Intergenic
1180765716 22:18345017-18345039 CCTGGCTGGATGAAATTGGCAGG - Intergenic
1180780593 22:18517361-18517383 CCTGGCTGGATGAAATTGGCAGG + Exonic
1180813313 22:18774682-18774704 CCTGGCTGGATGAAATTGGCAGG + Intergenic
1181167411 22:20991179-20991201 CCTGGGAGGTGGAAGGTGCTGGG + Intronic
1181199488 22:21208998-21209020 CCTGGCTGGATGAAATTGGCAGG + Exonic
1181400271 22:22646860-22646882 CCTGGCTGGATGAAATTGGCAGG - Exonic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1181649093 22:24248931-24248953 CCTGGCTGGATGAAATTGGCAGG + Intergenic
1181702247 22:24627958-24627980 CCTGGCTGGATGAAATTGGCAGG - Exonic
1181791586 22:25271413-25271435 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1181805288 22:25370869-25370891 CCTGGGAGGTGGAAGCTGCTGGG + Intronic
1183487213 22:38095073-38095095 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1183691534 22:39392319-39392341 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1183860669 22:40667752-40667774 CCTGGGAGGCGGAAGTTGCGGGG - Intergenic
1184094513 22:42309360-42309382 CCTGGCATGTGGCAGTTCACAGG - Intronic
1184178298 22:42802238-42802260 CGTGGGAGGTGGAAGTTTCCAGG + Intronic
1184381367 22:44146892-44146914 CCTGGAGGATGGAAGTTGGGGGG + Intronic
1184443290 22:44532175-44532197 CCTGGGAGGTGGAGGTTGCCAGG - Intergenic
1184707374 22:46223872-46223894 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1184720405 22:46309343-46309365 CCTGGGAGGTGGCAGTTGACAGG + Intronic
1203227338 22_KI270731v1_random:85908-85930 CCTGGCTGGATGAAATTGGCAGG - Intergenic
1203256404 22_KI270733v1_random:140913-140935 CCTGGAAGGTGGCAGGTAGCCGG - Intergenic
1203263415 22_KI270734v1_random:364-386 CCTGGCTGGATGAAATTGGCAGG + Intergenic
950005307 3:9687625-9687647 CCTGGCAGATGCATGTGGGCCGG - Intronic
950176904 3:10881338-10881360 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
950390609 3:12693781-12693803 CCTGGCATCTGGAACTGGGCTGG - Intergenic
951440205 3:22714086-22714108 CCTGGCAGGAGGAAGTAGTGGGG - Intergenic
952026187 3:29085798-29085820 CCTGGGAGGTGGAAGGTGTAGGG - Intergenic
952409111 3:33031566-33031588 CCAGGGAGGTGGAAGTTGCCTGG + Intronic
952625028 3:35393149-35393171 TCTGTGAGGTGGGAGTTGGCTGG + Intergenic
952846392 3:37691140-37691162 CCTGGCAGCTGGAAGTGGGCTGG + Intronic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
952918559 3:38267899-38267921 CCTGGCAGCAGGAAGCAGGCAGG + Intronic
953660199 3:44886263-44886285 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
953708211 3:45247148-45247170 CCCGGGAGGTGGAGGTTGCCAGG - Intergenic
954762558 3:52887263-52887285 CTTGGGAGGTGGAAGGAGGCTGG - Intronic
954862922 3:53705191-53705213 TCTGGCTGGTGGGAGTGGGCAGG + Intronic
954940397 3:54367024-54367046 CCTGCCAGGTGGAAGTTGTTAGG + Intronic
955201973 3:56859606-56859628 CCTGGGAGGTGAAAGTTGCAGGG - Intronic
955409046 3:58644014-58644036 CCTGGCTGCTGGAAGGAGGCAGG + Intronic
955735051 3:62029886-62029908 TGTGACAGGTGGAAGGTGGCCGG - Intronic
956891608 3:73619717-73619739 CCAGGCAGGTGGAAGCCGGTAGG + Intronic
957038373 3:75315926-75315948 CCTTGCAGGTATAAGTTTGCTGG + Intergenic
957767443 3:84644212-84644234 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
957945685 3:87059366-87059388 CCTGGGAGGTGGACGTTGCAGGG + Intergenic
959122608 3:102250640-102250662 CCTGGCAGATTGAGATTGGCAGG + Intronic
959383127 3:105666608-105666630 CCTGGGAGGTGGAAATTGCTGGG + Intronic
959468159 3:106715831-106715853 CCTGGGAGGTGGAGGTTGCTGGG - Intergenic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
961079526 3:124014227-124014249 CCTGGCAGATGGAAGATGTCTGG - Intergenic
961086402 3:124071240-124071262 CCTTGCAGGTATAAGTTTGCTGG + Intergenic
961254555 3:125537082-125537104 CCTAGGAGGTGGAAGTTGCAGGG + Intronic
961629972 3:128289414-128289436 CCTGGCAGGAGGCAGATGGAGGG + Intronic
961690275 3:128664450-128664472 CCTGGGAGGTGGAGGTTGTGGGG + Intronic
962559076 3:136587462-136587484 CCTGGAAGGTGGAGGTTGCAGGG + Intronic
963132570 3:141872339-141872361 CCTGGGAGGTGGAGGTTGTGGGG + Intergenic
964172297 3:153785101-153785123 TTGGGAAGGTGGAAGTTGGCAGG - Intergenic
964381992 3:156106675-156106697 CCTGGAAGGTGGAGGTTGCCAGG - Intronic
965062313 3:163800272-163800294 GCTGCCAGGTGGAAGTTGTTAGG + Intergenic
965410238 3:168321141-168321163 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
965514455 3:169605991-169606013 CCAAGCAGGTGAAAGTTGACTGG + Intronic
965622022 3:170651409-170651431 CCTGGGAAGTGCAAGGTGGCAGG - Intronic
966245719 3:177805422-177805444 CCTGGGAGGTGGAGGTTGTAGGG + Intergenic
966427440 3:179794494-179794516 CCTGGCAGGTGGAAGATCATGGG - Intergenic
966708821 3:182949285-182949307 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
966807799 3:183820016-183820038 CCTGTCAGGTGGAAGGAGCCAGG + Intronic
966993643 3:185258965-185258987 CCTGTCAGGTGGTAGGGGGCTGG - Intronic
967940622 3:194763437-194763459 CCTGGGAGGTGGAGGTTGCGGGG + Intergenic
968221034 3:196940294-196940316 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
968652446 4:1765623-1765645 CCTGGGAGATGGCAGTGGGCAGG + Intergenic
968716646 4:2164725-2164747 CCTGGGAGGTGGACGTTGCAGGG + Intronic
968824350 4:2882935-2882957 CCTGGGAGGTGGTAGTTTGCAGG - Intronic
969085862 4:4655881-4655903 CCTGGGAGGTGGAGGTTGTGGGG + Intergenic
969758974 4:9168915-9168937 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
969869399 4:10095361-10095383 CCTGGGATGTGGAAGTTCTCAGG - Intronic
970004219 4:11395551-11395573 CCTGGCAGGTGGAGGTTGCAGGG - Exonic
970332114 4:14997614-14997636 CCTGGGAGGCGGAAGTTGCAGGG - Intergenic
971579117 4:28310663-28310685 TTTGGAAGGTGGAAGTTGGAAGG + Intergenic
971876715 4:32318118-32318140 CCTGGCAGGCTGCACTTGGCTGG + Intergenic
972201890 4:36722438-36722460 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
972493860 4:39614395-39614417 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
972514690 4:39800764-39800786 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
972542055 4:40047815-40047837 CCTGGGAGGTGGAGGTTGCAAGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
974372653 4:61037811-61037833 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
975164645 4:71164303-71164325 CCTGGGAGGTGGAGGTTGTAGGG + Intergenic
975774583 4:77771235-77771257 CCTGGGAGGCGGAGGTTGCCGGG + Intronic
976397023 4:84566933-84566955 GATGGCAGGGGGAAGATGGCAGG + Intergenic
976729288 4:88245558-88245580 CCTGGCAGGCTGATCTTGGCTGG - Intergenic
978194113 4:105950735-105950757 CCTGACAGGTGCAGGTTGTCAGG - Intronic
978429377 4:108617851-108617873 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
978508087 4:109482712-109482734 CCTGGGAGGCGAAGGTTGGCAGG - Intronic
978922779 4:114204250-114204272 CCTGGGAGGTGGAGGTTGCATGG + Intergenic
979408391 4:120342850-120342872 CCTGGGACTTGGAAGTTGGCAGG + Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981723251 4:147822558-147822580 CGTGCCAGGTTGAAGATGGCGGG + Intronic
981987285 4:150873512-150873534 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
983246990 4:165298859-165298881 CCCGGCAGGTGGAGTTTGCCAGG + Intronic
983785558 4:171725714-171725736 CCTTGAGGGTGGAAGTTGGGAGG + Intergenic
984169462 4:176343399-176343421 CATGGCAGGTTGATGGTGGCAGG - Intergenic
984914435 4:184708146-184708168 CCTGGGAGGTGGAAGTTGCAGGG + Intronic
985654924 5:1125847-1125869 CCTGGGAGGCGGAAGTTGCAGGG + Intergenic
985663785 5:1171130-1171152 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
985878553 5:2619566-2619588 CTTAGCAGCTGGAAGTTGGCTGG - Intergenic
986209832 5:5661467-5661489 CCTGGGAGGTGGACGTTACCTGG + Intergenic
987714321 5:21547111-21547133 CCTGGCTTCTGGTAGTTGGCTGG + Intergenic
988077956 5:26377314-26377336 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
988124877 5:27017785-27017807 CTTGGGAGGTAGAAGCTGGCAGG + Intronic
988148972 5:27350914-27350936 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
988475982 5:31586381-31586403 CATGGCAGGAGGAATTTGTCAGG + Intergenic
988480000 5:31621605-31621627 CCTGGCACATGGAAGCTGGGTGG - Intergenic
988713801 5:33804482-33804504 CATGTCAGTTGGGAGTTGGCTGG - Intronic
988998597 5:36738260-36738282 CTTGGGAGGATGAAGTTGGCAGG - Intergenic
989593599 5:43135072-43135094 CCTGGGAGGCGGAGGTTGGGGGG - Intronic
989689479 5:44123648-44123670 CCTGGCAGGTGGAGCTTGCAGGG - Intergenic
990012833 5:51021069-51021091 CCTGGCTGAGGGAAGGTGGCAGG + Intergenic
990222214 5:53605143-53605165 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
991685019 5:69173843-69173865 CCTGGCAGGTGGAGGTTGCAGGG - Intronic
992109457 5:73479227-73479249 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
992240768 5:74767138-74767160 GCTGGCAGGCGGCATTTGGCCGG - Exonic
994033792 5:95175774-95175796 CCTGGCAGGTGTGAGTGGGTGGG - Intronic
995906489 5:117130371-117130393 CTTGGCAGGTGGAAGGTGGGAGG - Intergenic
996728867 5:126697806-126697828 CCTGGGAGGTGGAGGTTGAATGG + Intergenic
997312716 5:132902121-132902143 CCTGGGAGGTGGAGGTTGTAGGG - Intronic
997556084 5:134800021-134800043 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
998002551 5:138636397-138636419 TGTGGCAGGTGGAAGATGGGAGG + Intronic
998291630 5:140920766-140920788 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
999155972 5:149457820-149457842 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
999258833 5:150225367-150225389 CCTGGAGGGTGGAACTTGGCCGG + Intronic
999265580 5:150264876-150264898 CCTGGCACGTGGGTGTTTGCGGG - Intronic
999567309 5:152878798-152878820 CCTGGGAGGTGGAAGTTGCAGGG + Intergenic
1000059640 5:157642238-157642260 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001399749 5:171439421-171439443 CCTGGCAGGTGGGAGGTTGTGGG + Intronic
1002096070 5:176831690-176831712 TCTGGGAGGTGGAGGTGGGCAGG - Intronic
1002307737 5:178293685-178293707 TCTGGCATGGGGAAGCTGGCAGG + Intronic
1002505351 5:179675615-179675637 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1002560909 5:180081421-180081443 CCTGCCAGGTGAACGCTGGCTGG + Intergenic
1003221525 6:4164955-4164977 CCTCGGGGGTGGAAGATGGCAGG - Intergenic
1003370216 6:5517534-5517556 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1003866706 6:10369754-10369776 CCTGGGAGGCGGAAGTTGCAGGG + Intergenic
1004376036 6:15091657-15091679 CCTGGGAGGCGGAAGTTGCAGGG - Intergenic
1004980572 6:21019022-21019044 CGTGGCAGGTGGAGGTTGCAGGG - Intronic
1004992209 6:21150727-21150749 CCTGTCAGGACGAAGTTGACAGG - Intronic
1005617689 6:27590953-27590975 CCTGGGAGGTGGATGTTGCAGGG + Intergenic
1005631684 6:27713921-27713943 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1005655840 6:27936829-27936851 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1005821669 6:29604256-29604278 CCTGGCAGGTGGAAGGGCTCTGG - Intronic
1005951842 6:30637605-30637627 CCTGGGAGGTGGAAGTTGCAGGG + Intronic
1006046438 6:31302957-31302979 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1006559928 6:34902322-34902344 CCCGGCAGGTGGAGGTTGCAGGG - Intronic
1006834986 6:36992699-36992721 CCTGGCAGGTGGAACTTGCGTGG - Intergenic
1006897513 6:37480354-37480376 CCTGGCAGGGGAAAGTTCCCAGG - Exonic
1007676639 6:43601339-43601361 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1008897587 6:56575419-56575441 AATGGCAGCTTGAAGTTGGCAGG + Intronic
1009002407 6:57734968-57734990 CCTGGCTTCTGGTAGTTGGCTGG - Intergenic
1009264941 6:61542084-61542106 ACTTGCAAGTGGAAGTTGGCTGG - Intergenic
1010194904 6:73229555-73229577 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1011647205 6:89471274-89471296 CTTGGGAGGTGGAGGTTGCCTGG + Intronic
1012295124 6:97512819-97512841 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1012707007 6:102544236-102544258 ACTTGAAGGTGGAAGGTGGCAGG + Intergenic
1012887130 6:104859364-104859386 CCCGGCAGGTGGGAGTTTTCGGG - Intronic
1012963099 6:105643737-105643759 CCAGGGAGGTGGCAGCTGGCTGG + Intergenic
1014910001 6:127080335-127080357 CCTGGGAGATGGAAGTTGCATGG + Intergenic
1015336898 6:132049397-132049419 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1015434407 6:133169221-133169243 CCTGGCAGGTAGAACTTTGCAGG - Intergenic
1015793458 6:136987088-136987110 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1017142924 6:151208055-151208077 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1017556433 6:155576140-155576162 CCGGGCTGGTGGTGGTTGGCAGG + Intergenic
1018392669 6:163352427-163352449 CTGGGCGGGTGGAAGTGGGCAGG - Intergenic
1018920262 6:168167693-168167715 CCTGACAGGTGGAGGCTGGGTGG - Intergenic
1019425600 7:975235-975257 CCCTGCAGGTGGGAGCTGGCAGG - Intronic
1019715883 7:2539164-2539186 CCCGGCAGGTAGGAGGTGGCAGG - Exonic
1019748611 7:2714730-2714752 GCTGCCAAGTGGAATTTGGCTGG + Exonic
1020510954 7:9056548-9056570 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1021760933 7:23902741-23902763 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1023453957 7:40318510-40318532 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1023727173 7:43155347-43155369 CATGGCAACTGGAAGTTGGAGGG + Intronic
1023812418 7:43922138-43922160 CCTGGGAGGTGGAGGTTGCCAGG - Intronic
1023815829 7:43949326-43949348 CCTGGCAGGTGGAGCGTGGGAGG + Intronic
1024354467 7:48400279-48400301 CCTAGCAGGTGGCAGGTGCCAGG + Intronic
1024430649 7:49284557-49284579 CCTGGAGGGTGGAAGTTCCCTGG + Intergenic
1025627537 7:63234506-63234528 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1026118363 7:67515394-67515416 CCTGGCTGGTGGAATTTGCAGGG - Intergenic
1027243957 7:76353286-76353308 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1027260950 7:76464180-76464202 CCTGGAAGGTGGTAGTTGAGGGG + Intronic
1028297733 7:89156187-89156209 CCTGGGAGGTGGAGGTTGTGGGG - Intronic
1029104283 7:98162865-98162887 GCTGGGAGGTGGAAGTGGCCAGG + Intronic
1029179538 7:98690144-98690166 TCAGGCAGGTGGCAGGTGGCAGG - Intergenic
1029701043 7:102247116-102247138 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1029947211 7:104545355-104545377 TCTGGGAGATGGAAATTGGCAGG - Intronic
1030119126 7:106089072-106089094 CCTGGCAGGTGGAGGTTAACAGG + Intergenic
1030395202 7:108977905-108977927 CCTGTCAGGGGGTAGTGGGCTGG - Intergenic
1030477980 7:110061820-110061842 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1030573596 7:111258580-111258602 CCTGGAAGGTGGAGGGTGCCAGG - Intronic
1031726040 7:125240732-125240754 CCTGGCAGGCGGAGGTTGTAGGG - Intergenic
1032449420 7:132017080-132017102 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1032595581 7:133236400-133236422 CCTGGGAGGTGGAAGCTGCAAGG - Intergenic
1033127815 7:138720396-138720418 GGTGGCAGGTGGAAATTGTCTGG + Intronic
1033558069 7:142506375-142506397 CCTGGGAGGAGGGTGTTGGCTGG + Intergenic
1033587959 7:142788150-142788172 CCTGGCAGGTGGACTTGGGGAGG + Intergenic
1034041095 7:147877250-147877272 TCTGGCAGCTGGCAGTTTGCAGG - Intronic
1034957519 7:155344243-155344265 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1035182225 7:157097714-157097736 GGTGGCAGGTGGCAGGTGGCAGG + Intergenic
1035280413 7:157775056-157775078 CCTGGCATGTGGACGTTTTCAGG - Intronic
1035326265 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG + Intronic
1035328166 7:158078321-158078343 CCAGGCAGCTGGCAGGTGGCAGG + Intronic
1035562276 8:614845-614867 CGTGACAGGTGGAAGTTGGATGG + Intronic
1036246909 8:7125755-7125777 CTTTGCTGGTGGCAGTTGGCTGG + Intergenic
1036685676 8:10908411-10908433 CCTGGGAGGGGGAAGCAGGCTGG - Intronic
1036847534 8:12180041-12180063 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1036868902 8:12422359-12422381 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1037568672 8:20140362-20140384 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1037932543 8:22890656-22890678 CCTGGCAGGTGGCAGGTAGCAGG + Intronic
1039018618 8:33181104-33181126 ACTGGAGGGTGGAAGTTGGGAGG - Intergenic
1039316719 8:36381786-36381808 CCTGGGAGGTGGAAGTTGAAGGG + Intergenic
1039433297 8:37542628-37542650 CCTGGGAGGTGGAGGTTGCAAGG - Intergenic
1039544139 8:38396237-38396259 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1039995994 8:42533733-42533755 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1040036714 8:42877292-42877314 CCCGGGAGGTGGAAGTTGCAGGG - Intronic
1041199994 8:55444093-55444115 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1042186177 8:66138463-66138485 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1043072621 8:75657768-75657790 GCTGGCAACTGCAAGTTGGCAGG + Intergenic
1045506079 8:102779676-102779698 CCTGCCAGGTGGAACTTTGAGGG - Intergenic
1045894353 8:107196280-107196302 CCTGGGAGGTGGGAGTAGGGAGG - Intergenic
1046308781 8:112405105-112405127 CCTGGGAGGCGGAAGTTGCAAGG + Intronic
1048659773 8:136586063-136586085 CCTGGGAGGCGGAAGTTGTAGGG - Intergenic
1049137418 8:140915824-140915846 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1049844653 8:144793931-144793953 ACTGTCAGGTGGATGCTGGCAGG - Intergenic
1050536784 9:6637540-6637562 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1050551045 9:6748429-6748451 CCTGGGAGGTGGAGGTTGCGGGG + Intronic
1051363625 9:16304423-16304445 CCTTGGAGGTGGAAGACGGCAGG - Intergenic
1052287868 9:26807176-26807198 TTTGGCAGGTGGAGGTAGGCAGG - Intergenic
1052460314 9:28754704-28754726 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1052863070 9:33448597-33448619 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1053297101 9:36922953-36922975 CCTTGCAGATTGATGTTGGCAGG - Intronic
1055672124 9:78618270-78618292 GCTGGCTGATGGAAGTAGGCTGG - Intergenic
1056299349 9:85226000-85226022 GCTGGCAGGTGGAAGGGCGCGGG - Intergenic
1056362961 9:85877532-85877554 CCTGGGAGGTGGAGGTTGCTGGG - Intergenic
1056429318 9:86511655-86511677 CCTGGCAGGTGGAAGATCTCTGG - Intergenic
1057337933 9:94171766-94171788 CCTGGAAGGTGGAGGTTGCATGG - Intergenic
1057446493 9:95119439-95119461 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1058077273 9:100663790-100663812 CCTGGAAGGTGGAGGTTGCAGGG - Intergenic
1058704379 9:107626724-107626746 CCTGGGAGGTGGAGGTTGCAAGG - Intergenic
1058802171 9:108555229-108555251 CCTGGCTGGTGGGAGTGGGAGGG + Intergenic
1059284562 9:113161606-113161628 GCTGGCTGATGGAGGTTGGCAGG - Exonic
1059333415 9:113551781-113551803 CCTGGGAGGTGGAGGTTGCACGG + Intronic
1059518156 9:114914799-114914821 CCTGTGAGGTGTCAGTTGGCTGG + Intronic
1060233397 9:121842010-121842032 CCTGAGAGGTGGAAGAAGGCAGG - Intronic
1060727941 9:126018240-126018262 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1061067483 9:128287635-128287657 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1061441483 9:130607044-130607066 CCGGGGAGGTGGAAGTTGCAGGG - Intronic
1061519311 9:131108273-131108295 CCTGGGAAGTGGAGGTTGCCGGG - Intronic
1061550019 9:131329009-131329031 CCTGGCAGGTATCAGTGGGCTGG - Intergenic
1061657776 9:132106111-132106133 CCTGGGAGGTGGAGGTTGTAGGG - Intergenic
1062487880 9:136789956-136789978 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1062671095 9:137709853-137709875 ACTGGAAGCTGGAAGTGGGCAGG - Intronic
1203472560 Un_GL000220v1:122613-122635 CCTGGAAGGTGGCAGGTAGCCGG - Intergenic
1185510434 X:660139-660161 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1185793938 X:2948996-2949018 CCTGGGAGGTGGAGGTTGCAGGG - Intronic
1186891086 X:13959862-13959884 ACTGGCAGTTAGAAGTTGGCTGG + Intergenic
1187163040 X:16781967-16781989 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1187175647 X:16894157-16894179 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1187562906 X:20419096-20419118 CCTGGGAGGTGGTATCTGGCTGG + Intergenic
1187885634 X:23886301-23886323 CCGGGGAGGTGGGAGTTGGAAGG + Intronic
1188318363 X:28704766-28704788 TCTGGCAGCGGCAAGTTGGCAGG + Intronic
1189246917 X:39570433-39570455 ACTGGCAAGTGGAAGTCTGCTGG - Intergenic
1189838370 X:45043212-45043234 CCTGGGAGGTGGAAGTTGCAGGG + Intronic
1189908439 X:45785240-45785262 CCTGGAAAGTGGAAGTTGCAGGG + Intergenic
1190238127 X:48633205-48633227 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1190762580 X:53449060-53449082 CCTGGGAGGCGGAAGTTGCAGGG - Intergenic
1190764484 X:53464702-53464724 CCTGGGAGGTGGGAGTTGCAAGG - Intergenic
1190877843 X:54472200-54472222 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1192470097 X:71390917-71390939 CCTGGGAGGTGGAGGTTGCCGGG + Intronic
1192480003 X:71477012-71477034 CCTGGGAGGTGGAGGTTGTAGGG - Intronic
1193237378 X:79124077-79124099 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1196210075 X:112986312-112986334 CCTGGGAGGTGGAGGTTGCATGG + Intergenic
1196504879 X:116430014-116430036 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1198149711 X:133896283-133896305 CCTGGGAGGTGGAGGTTGCAGGG + Intronic
1198636720 X:138710363-138710385 CCTTGGAGGTGGAAGCTGGAGGG + Intronic
1199141333 X:144316867-144316889 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1199396390 X:147343696-147343718 CCTGGGAGGTGGAGGTTGCAGGG - Intergenic
1200727536 Y:6690750-6690772 TTTGGGAGGTGGAAGTTGGGGGG - Intergenic
1200811913 Y:7494548-7494570 CCTGGGAGGTGGAGGTTGCAGGG + Intergenic
1201773363 Y:17639940-17639962 CCTGACAGGTGCAGGTTGTCAGG - Intergenic
1201828192 Y:18266046-18266068 CCTGACAGGTGCAGGTTGTCAGG + Intergenic