ID: 920044942

View in Genome Browser
Species Human (GRCh38)
Location 1:203127089-203127111
Sequence TAGCACAGCGCTAAGCCATA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920044942_920044946 -1 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG 0: 1
1: 2
2: 50
3: 501
4: 3121
920044942_920044945 -5 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044945 1:203127107-203127129 TGCTATGAAGAGGAAGAAGGAGG 0: 1
1: 1
2: 5
3: 58
4: 584
920044942_920044947 5 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044947 1:203127117-203127139 AGGAAGAAGGAGGAAGGAAAAGG 0: 1
1: 5
2: 85
3: 773
4: 4563
920044942_920044948 17 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044948 1:203127129-203127151 GAAGGAAAAGGAGCGCAGAGCGG 0: 1
1: 0
2: 15
3: 81
4: 757
920044942_920044944 -8 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 369
920044942_920044949 18 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044949 1:203127130-203127152 AAGGAAAAGGAGCGCAGAGCGGG 0: 1
1: 0
2: 0
3: 39
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920044942 Original CRISPR TAGCACAGCGCTAAGCCATA AGG (reversed) Exonic
902275013 1:15333280-15333302 TAGCCCAGAGCTAATCCAGAAGG + Intronic
904615886 1:31749378-31749400 AAGCACACTGCAAAGCCATATGG + Intronic
907733482 1:57089640-57089662 AAGGACAGCACTAAGCCATGCGG + Intronic
911750079 1:101486622-101486644 TAGAAAAGCGGTAAGGCATAGGG + Intergenic
917045811 1:170858895-170858917 TAGGACAGCACCAAGCCATGAGG - Intergenic
917210545 1:172627625-172627647 TGCCACAGCTCTCAGCCATAAGG + Intergenic
920044942 1:203127089-203127111 TAGCACAGCGCTAAGCCATAAGG - Exonic
920798542 1:209164091-209164113 AAGGACAGCACCAAGCCATAAGG - Intergenic
921107434 1:211996737-211996759 TACCACTGCGCCAGGCCATATGG - Intronic
921929501 1:220743506-220743528 TATCACAGCAGTAAGCAATATGG - Intergenic
1065626590 10:27635513-27635535 AAGGACAGCGCCAAGCCATGAGG - Intergenic
1067243955 10:44520453-44520475 TAGCACAGTGCTTACCAATAGGG - Intergenic
1069749848 10:70738226-70738248 TAGCACAGGGCCAGGCAATAAGG - Intronic
1074221635 10:111443898-111443920 TAGCACAGGACAAAGCCAGATGG + Intergenic
1074310575 10:112319374-112319396 TAGCACAAAAGTAAGCCATAAGG + Intergenic
1075228033 10:120647206-120647228 AAGAACAGCACTAATCCATATGG - Intergenic
1080480743 11:32647362-32647384 GAGGACAGCACCAAGCCATAAGG + Intronic
1087993855 11:104779588-104779610 CAGTACAGCACCAAGCCATAAGG - Intergenic
1092829289 12:12428203-12428225 TAGCACAGTGCAGAGCCATATGG - Intronic
1102402863 12:112645879-112645901 TAGAAGAGTGGTAAGCCATAAGG + Intronic
1105073813 12:133256888-133256910 AAGCACAGAGCTAAGCCTTTAGG - Intergenic
1107434967 13:40374067-40374089 TAGCACAGGCCTAAGACAGAGGG - Intergenic
1116693172 14:48136621-48136643 AAGCACAGTGCTAAGTGATATGG - Intergenic
1117964936 14:61197369-61197391 TAGTACTGGGCTAAGCCCTATGG - Intronic
1118134827 14:63011755-63011777 AAGCACAGCCCTCAGCCAAATGG + Intronic
1125610552 15:40966474-40966496 TGGCCCAGCGCCAAGCCAGAAGG - Intergenic
1129127467 15:73455765-73455787 TAGCACAGCTCTAAACCATTGGG - Intronic
1131759858 15:95610568-95610590 TTGCACAGTTCTAAGCAATAGGG - Intergenic
1141222872 16:82088020-82088042 AACCACAGCGCTTACCCATAAGG + Intronic
1143702272 17:8669849-8669871 TAGCACAGTGTCAACCCATATGG - Intergenic
1144543475 17:16169230-16169252 TGGAACAGGGCTAACCCATAAGG - Intronic
1150116057 17:62550525-62550547 TAGCACAGTGCTTAGACATAGGG + Intronic
1151122321 17:71807217-71807239 GAGGACAGCGCCAAGCCATGAGG + Intergenic
1153738179 18:8095010-8095032 TAGCACAGCTGTAAGATATAAGG - Intronic
1155089245 18:22490119-22490141 TACCACACCCCTGAGCCATATGG + Intergenic
1159910985 18:74146681-74146703 TATCACAGCACTAAGCAACAGGG + Intronic
1166656943 19:44619211-44619233 GAGGACAGCGTCAAGCCATAAGG + Intronic
925503411 2:4532578-4532600 TATCACAGTGCTATGCAATAGGG + Intergenic
929761200 2:44808384-44808406 TGGCACTAGGCTAAGCCATATGG + Intergenic
933164966 2:79065706-79065728 GAGGACAGCACTAAGCCATGAGG - Intergenic
937791779 2:125969620-125969642 GAGGACAGCGCCAAACCATAGGG - Intergenic
938830003 2:135040913-135040935 CAGCCCAGAGATAAGCCATATGG - Intronic
939364523 2:141215097-141215119 GAGGACAGCACCAAGCCATAAGG - Intronic
941389197 2:164890801-164890823 GAGCACAGCTTTAAGCCATGTGG + Intergenic
943158963 2:184221894-184221916 TAGGACAGGGCTAAATCATATGG - Intergenic
943908474 2:193531225-193531247 TTGCACAGGTCTAAGACATAGGG - Intergenic
947455191 2:230247789-230247811 AAGCACAGGGCTAAGCCTTTAGG - Intronic
948328698 2:237148465-237148487 TGGCACAGTGCTAAGCCCCATGG + Intergenic
1174419510 20:50390525-50390547 TAGCTCAGAGCTAAGGCAGAGGG + Intergenic
1182379129 22:29872288-29872310 TAGCACAGTGGTTAACCATAGGG + Intergenic
1183442696 22:37832181-37832203 TAGGACAGCGCTAGGCCACCTGG - Intronic
1184447649 22:44559635-44559657 GAGAACAGCACCAAGCCATAAGG + Intergenic
949464676 3:4332401-4332423 AAGCACAGAGCTAAGGCATTAGG + Intronic
949508121 3:4745480-4745502 TAGCACAGCATTAAGCCATAAGG - Intronic
953833784 3:46325933-46325955 GAGGACAGCACCAAGCCATAAGG + Intergenic
965741550 3:171880342-171880364 TATCACTGTGCTAAGCAATATGG - Intronic
969850434 4:9952301-9952323 GAGGACAGCACTAAGCCATGAGG - Intronic
971256808 4:25022043-25022065 TAGCACAGGGCTAAGCCAGCAGG - Intronic
973884540 4:55307080-55307102 AAGGACAGCACTAAGCCATGAGG - Intergenic
975435452 4:74345805-74345827 GTGCACAGCACTAAGCCATGAGG + Intergenic
975609638 4:76191434-76191456 GAGGACAGCACTAAGCCATGAGG - Intronic
977498329 4:97804927-97804949 TACTACACAGCTAAGCCATATGG - Intronic
978017068 4:103757652-103757674 TAGGACAGCACCAAGCCATGAGG + Intergenic
983524700 4:168749073-168749095 CAGGACAGCACTAAGCCATAAGG - Intronic
984341350 4:178460361-178460383 TAGTACAGGGCAAACCCATATGG + Intergenic
984745467 4:183211662-183211684 CTGCACAGAGCTAAGGCATAGGG - Intronic
985056064 4:186036506-186036528 AAGGACAGCACCAAGCCATAAGG - Intergenic
987579848 5:19775600-19775622 TAAAACAGCACTAAGCCATGAGG + Intronic
989545760 5:42671364-42671386 AAGGACAGCACCAAGCCATAAGG + Intronic
990417473 5:55599899-55599921 AAGCACAGGACTCAGCCATAGGG - Intergenic
992023349 5:72647270-72647292 TGGCACAGAGCAAAGCCAGAGGG + Intergenic
993645811 5:90459707-90459729 TAGCACAGCGCTAAACACTGTGG - Exonic
994520962 5:100834668-100834690 AAGGACAGCACCAAGCCATAAGG - Intronic
998991655 5:147823842-147823864 TAGCACAGCACAAACCCATCAGG + Intergenic
1004400970 6:15288380-15288402 TAGGACAGCACCAAGCCATGAGG + Intronic
1007656025 6:43451479-43451501 TAGCACAGGGCCCAGCCAGAAGG + Intronic
1007880543 6:45160974-45160996 AAGGACAGCACTAAGCCATGAGG - Intronic
1012485198 6:99713468-99713490 TAGCACAGTGATTAGGCATATGG - Intergenic
1012927545 6:105282768-105282790 TACCACAATGCTAATCCATATGG + Intronic
1014932233 6:127348719-127348741 TAGCACAGAGCTGAGACTTATGG + Intergenic
1016372761 6:143391872-143391894 GAGAACAGCACTAAGCCATGAGG - Intergenic
1016694221 6:146974055-146974077 TCACACAGCTCTTAGCCATATGG + Intergenic
1017019896 6:150131534-150131556 TAGGACAGCACCAAGCCATTCGG - Intergenic
1020451631 7:8326260-8326282 TAGCACAGGACTAAGGCAGAAGG - Intergenic
1021054421 7:16029317-16029339 TAGCACAGAGCTAAGCCTGTTGG - Intergenic
1022097852 7:27151989-27152011 TGGCACAGCGCCAAGGCACAGGG - Intronic
1025251441 7:57353956-57353978 TAGCTCAGAGCTAAGGCAGAGGG - Intergenic
1027491667 7:78834794-78834816 AAGTACAGCACCAAGCCATAAGG - Intronic
1027528375 7:79299805-79299827 AAGCACAGCACCAAGCCATGAGG - Intronic
1028792181 7:94865460-94865482 TAGGACAGCACCAAGCCATGAGG - Intergenic
1032045781 7:128606331-128606353 TAGCACAGTGCTTAGACATAGGG + Intergenic
1035494385 7:159310315-159310337 AAGCACAGAGCTAAGCCTTTAGG - Intergenic
1040589936 8:48782306-48782328 TAGCACAGTGCTAAGACCTGTGG + Intergenic
1040643216 8:49366174-49366196 TAGCACAGTGCCAAACTATACGG + Intergenic
1043533780 8:81177673-81177695 GAGAACAGCACCAAGCCATAAGG + Intergenic
1047144668 8:122184763-122184785 TAGCAAGGCGGTAAGTCATATGG - Intergenic
1048733426 8:137470365-137470387 TAGGACAGCACCAAGCCATGAGG - Intergenic
1059884947 9:118735576-118735598 AAGGACAGCACCAAGCCATAAGG - Intergenic
1059949771 9:119450231-119450253 TAGCACAGCTCTAAAACACAGGG - Intergenic
1191649001 X:63516036-63516058 GAGAACAGCACTAAGCAATAGGG + Intergenic
1195386527 X:104318689-104318711 TAGCCCAGTGCTTAGCCAAAAGG - Intergenic
1198600022 X:138272428-138272450 AAGGACAGCACTAGGCCATAAGG + Intergenic