ID: 920044944

View in Genome Browser
Species Human (GRCh38)
Location 1:203127104-203127126
Sequence CTGTGCTATGAAGAGGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920044942_920044944 -8 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920044944 Original CRISPR CTGTGCTATGAAGAGGAAGA AGG Exonic
901539808 1:9908686-9908708 AAGTGCTATGAAGATGGAGAGGG - Intronic
901915063 1:12492733-12492755 ATGTGCCATCAACAGGAAGATGG + Intronic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
903503085 1:23812713-23812735 GTGTACCATGAAGAGGAAGCAGG + Intronic
903510855 1:23874010-23874032 CTATGCTATGATGAGGATTAAGG - Exonic
904774100 1:32896125-32896147 CTGGACTATGAGGAGGCAGATGG - Intronic
904945187 1:34193932-34193954 CTGTGGTATGTAGAGGAGAATGG + Intronic
905896191 1:41547434-41547456 CTGGGCTTTGAAGATGAAGAAGG + Intronic
906085595 1:43130974-43130996 CTGTGCAAGGAACAGAAAGAAGG - Intergenic
906111419 1:43324778-43324800 CTGGACCATGAAGAGGAAGCAGG + Intergenic
906911860 1:49961033-49961055 CTGTGCCATGCTGAGGAAGATGG + Intronic
908702568 1:66918639-66918661 ATGTCCTATGAAGAGGAAACGGG - Intronic
909662543 1:78100005-78100027 CTGGGCAATGAAGAGGCAGAGGG + Intronic
911686465 1:100782319-100782341 ATGTGCTATGAAGAAAAACAAGG - Intergenic
912836219 1:112998696-112998718 CGGTACAAGGAAGAGGAAGAGGG - Intergenic
913501802 1:119478588-119478610 GTGTGATATGAAGAGGGAGTGGG + Intergenic
914679847 1:149931427-149931449 CTGGGTGATAAAGAGGAAGAAGG + Intronic
915511093 1:156387543-156387565 CAGTCCTATGAAGTGGAACAAGG - Intergenic
916331051 1:163617524-163617546 CTGTGGCCTGGAGAGGAAGATGG + Intergenic
916695818 1:167235219-167235241 AAGCACTATGAAGAGGAAGATGG - Intronic
917531818 1:175842665-175842687 CTGGGTTTTGAAGAGGAAAAGGG - Intergenic
917637018 1:176947066-176947088 CTGTCTTATGTAGAGGAACAAGG + Intronic
918441309 1:184569851-184569873 CTGTGCTGTGGAGAGGACTATGG + Intronic
918825260 1:189315786-189315808 CTGTGCTTTTAAGAGAATGAGGG - Intergenic
919887372 1:201944688-201944710 CTTTGCCAAGAAGAGGGAGAAGG - Intronic
920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG + Exonic
920364507 1:205440960-205440982 CTGCAAAATGAAGAGGAAGAAGG - Intronic
920728531 1:208460983-208461005 CTGTGCTATCAAGAGCAATCAGG - Intergenic
921095788 1:211886274-211886296 CTGTGCTGTGGGGAGGAAGGTGG - Intergenic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921719040 1:218450173-218450195 CTGTGGTAGGAAGAGAAACAGGG + Intergenic
922291307 1:224210968-224210990 ATGTGCTGTGAAGAAGAAGCAGG - Intergenic
922741124 1:228014762-228014784 CTGTGACATGCAGGGGAAGAAGG - Intronic
923618537 1:235557823-235557845 CTCTGCTATGGAGTGGAACATGG - Intronic
923691373 1:236196657-236196679 CTGAGCTATGAAGATGCAAAGGG - Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
924140154 1:241013621-241013643 CTGAGCTATGAAATGGAGGAGGG - Intronic
1062842486 10:681818-681840 CTGAGCTCTGAAGAGGAGGAAGG - Intronic
1063430989 10:5988090-5988112 CTGTGCTCTTAGGAGGATGATGG - Intergenic
1063608145 10:7541057-7541079 CTATCCTATGCAGAGGAAAATGG + Intergenic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1065441060 10:25754193-25754215 ATCTGCTATGATGTGGAAGAGGG + Intergenic
1066222887 10:33353450-33353472 GTGTGCAATGAAGAATAAGAGGG - Intergenic
1066394722 10:35008119-35008141 CAGAGCTATGAAAAGGAAAAAGG - Intergenic
1066827294 10:39612348-39612370 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066827848 10:39628550-39628572 CTGCTCTATGAAAAGGAAGGTGG - Intergenic
1066843113 10:39957094-39957116 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066854994 10:40192046-40192068 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066856893 10:40229746-40229768 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066858277 10:40257251-40257273 CTGCTCTATGAAAAGAAAGATGG - Intergenic
1066858486 10:40261327-40261349 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066861680 10:40324810-40324832 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066863046 10:40351975-40351997 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066868645 10:40463685-40463707 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066869574 10:40482027-40482049 CTGCTCTATGAAAAGAAAGATGG - Intergenic
1066885129 10:40789726-40789748 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066897628 10:41036724-41036746 CTGCTCTATGAAAAGAAAGATGG - Intergenic
1066901264 10:41108365-41108387 CTGCTCTATGAAAAGAAAGATGG - Intergenic
1066902161 10:41126028-41126050 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066904962 10:41180719-41180741 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066907098 10:41222828-41222850 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066908227 10:41244913-41244935 CTGCTCTATGAAAAGAAAGATGG - Intergenic
1066910618 10:41291796-41291818 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066913733 10:41352594-41352616 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066914582 10:41369235-41369257 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066915103 10:41379421-41379443 CTGCTCTATGAAAAGAAAGATGG - Intergenic
1066916868 10:41414074-41414096 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1066917249 10:41421547-41421569 CTGCTCTATGAAGAGAAAGGTGG - Intergenic
1067243214 10:44514021-44514043 TTGTGCGATGTAGAGGAAGTTGG - Intergenic
1067709382 10:48636188-48636210 CTGTGCAGGGCAGAGGAAGAAGG - Intronic
1067728203 10:48789581-48789603 AGGTGCTAAGAAGAGCAAGAGGG - Intronic
1069114170 10:64483718-64483740 CTGTGCTAGGGAGAGAAAGCTGG - Intergenic
1069912963 10:71771036-71771058 GTTTGCTATGAAGGAGAAGATGG + Intronic
1070508848 10:77141162-77141184 CTGGGCTATCCAGAGGAAGATGG + Intronic
1072312317 10:94168233-94168255 GTGTCCTATGAAGAGGAAAGAGG + Intronic
1073363819 10:102920214-102920236 CTTTGCAATTAAGAGGGAGAAGG - Intronic
1074212395 10:111348470-111348492 ATGTGTTATGAAGATGAAGCTGG + Intergenic
1074837296 10:117309517-117309539 ATGAGCTATGAGGAGGGAGAAGG - Intronic
1075450798 10:122550834-122550856 TGGTGCTATGACGAGGAAGAAGG + Intergenic
1075663935 10:124217557-124217579 CAATGCTAACAAGAGGAAGAAGG + Intergenic
1075956535 10:126528146-126528168 CTCTGCTATGTAGAGAGAGACGG + Intronic
1077456966 11:2687145-2687167 CTGTGCTTTGTGGAGGAAGCTGG - Intronic
1078222236 11:9361531-9361553 TTGGGCTATGAAGAGGAATGAGG - Intergenic
1079568503 11:21913449-21913471 CTGTTCTATGAAGAGGAGCAAGG + Intergenic
1080095812 11:28404867-28404889 TGATGCTATCAAGAGGAAGATGG - Intergenic
1081312297 11:41588725-41588747 CTATGCTCTGAAGAGGATGCAGG - Intergenic
1081699223 11:45142307-45142329 TTGTTCTATGAAGTGGCAGAAGG - Intronic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1084270450 11:68026702-68026724 CTGTTCTCTGAGGAGGAAGTGGG - Intronic
1087879163 11:103394260-103394282 ATTTGCTATGAAAAGGAATACGG + Intronic
1087955044 11:104275925-104275947 CTGGGATATGAATGGGAAGAGGG + Intergenic
1088068459 11:105751794-105751816 CTATGCTATGAAGACACAGAAGG - Intronic
1088521767 11:110709675-110709697 TTGAAATATGAAGAGGAAGAAGG + Intronic
1089309710 11:117549738-117549760 CAGTTCTAAGAAGAGGAAAATGG - Intronic
1089402878 11:118174715-118174737 CTGGGCTAGGGTGAGGAAGAGGG - Intronic
1089654073 11:119934438-119934460 CTGTGGTAGGAAGAGGCAGAAGG - Intergenic
1090266699 11:125357739-125357761 CTGTGGTCTGAAGAGGAGGATGG + Intronic
1090990829 11:131815584-131815606 CTGTGCTCTGCAGAGGAAAGGGG + Intronic
1092998933 12:13977656-13977678 CTGTGCTGTGAGGGGGAAAAAGG + Intronic
1093367329 12:18320011-18320033 TTGTTTTGTGAAGAGGAAGAAGG - Intronic
1093551814 12:20421662-20421684 CTTTGCTATTAACAGGAAGTGGG + Intronic
1094292946 12:28872618-28872640 CTGGGCTTTGAAGAGTAGGAAGG + Intergenic
1095048228 12:37533682-37533704 CTGTGCAATGAAGGGAATGAGGG - Intergenic
1095324445 12:40871258-40871280 CTGTGCTATGTTCAGGAAGCAGG + Intronic
1096153404 12:49328909-49328931 CTGTCCTGTGAAGAAGAAAAAGG - Exonic
1096154080 12:49332215-49332237 CTCTGCTATGGGGAGGAAGAAGG - Intergenic
1096418157 12:51431728-51431750 CTGCTGGATGAAGAGGAAGATGG + Intronic
1097845735 12:64363528-64363550 CTTTGCGAGGAGGAGGAAGAGGG + Intronic
1098010940 12:66050859-66050881 CTGTACTACAAAGAGGTAGAAGG + Intergenic
1098418932 12:70270560-70270582 TTTTCCTATGAGGAGGAAGAAGG - Intronic
1098450015 12:70609653-70609675 TTGTGCTTTGAAGAGGGAGGTGG - Intronic
1098673687 12:73263183-73263205 CTGTGATCTGAAGGGTAAGAAGG + Intergenic
1100106618 12:91182793-91182815 CTGTGCTATGGAGTAGAAGCAGG - Exonic
1100391984 12:94151269-94151291 ATGTGCTTTGCAGAGAAAGAAGG - Intronic
1102618019 12:114171750-114171772 CTGGGGTAGGAAGAGGAAGAGGG + Intergenic
1102730165 12:115102154-115102176 ATGTGCTGTGAAGATGGAGAAGG + Intergenic
1102962521 12:117101880-117101902 CTGAGGTCTGAAGAGGAAGCGGG - Intergenic
1103266096 12:119631561-119631583 TTGGCCCATGAAGAGGAAGATGG + Intronic
1103339015 12:120211334-120211356 GTGAGCTATGAAGTGAAAGAGGG + Exonic
1104426659 12:128683407-128683429 CTGTTCTAGAAAGAGAAAGAAGG - Intronic
1104476132 12:129072095-129072117 CAATTCTATGGAGAGGAAGAAGG + Exonic
1104521517 12:129480193-129480215 GTGTGCAAGGGAGAGGAAGAAGG + Intronic
1106354993 13:28973154-28973176 CTATGATATGAATAGGAAGTTGG + Intronic
1107186352 13:37526048-37526070 GTGTTCTATGAAGAAGAAAATGG + Intergenic
1107263955 13:38528511-38528533 CTTTGCATTGTAGAGGAAGAAGG + Intergenic
1107733909 13:43375878-43375900 CTGTGTTAGGAAGAGGAGAAAGG - Intronic
1107872258 13:44758181-44758203 CTGTGCTATGATTAGGCAAATGG + Intergenic
1108683633 13:52800499-52800521 ATGTGCTATGAAGGCCAAGAGGG - Intergenic
1109049877 13:57466249-57466271 CTTGGCTGTGAAGATGAAGAGGG + Intergenic
1110675982 13:78244941-78244963 CTGTACTATAAGGAAGAAGATGG + Intergenic
1112154682 13:96804335-96804357 ATGTGGTATAAAGAGGAGGAGGG + Intronic
1113180278 13:107617267-107617289 CTGTTTTGTGAAGAGGGAGAGGG + Intronic
1113863135 13:113503135-113503157 CTTTGCTATTAAGAAAAAGAAGG - Intronic
1113948676 13:114059246-114059268 CTGTGCTGTGAAGATGCAGGAGG - Intronic
1114398060 14:22384499-22384521 CAGTGGTAGGTAGAGGAAGAAGG + Intergenic
1115116904 14:29891484-29891506 TTGTAATATGAAGATGAAGAAGG - Intronic
1115161622 14:30402903-30402925 CTTTCCCATGAAAAGGAAGATGG - Intergenic
1115583171 14:34782872-34782894 CTGTGCTGTATAGAGGAACAGGG - Intronic
1116054884 14:39851233-39851255 CTGTGTTTTGAAAAGGAAAATGG - Intergenic
1117995369 14:61473055-61473077 CTGTGTTTTGAAGATGAATAGGG + Intronic
1120384218 14:83823719-83823741 CTCTGGTGAGAAGAGGAAGAGGG - Intergenic
1120877649 14:89389614-89389636 CCGTGCTATAAAGACAAAGACGG + Intronic
1121025555 14:90613668-90613690 CTGGGCTATGAGGAGGAAATGGG - Intronic
1121791668 14:96704052-96704074 ATGTGCTATGAAGATGATGCAGG + Intergenic
1122017497 14:98808567-98808589 TTGTTCTTTGGAGAGGAAGAGGG - Intergenic
1122658842 14:103280823-103280845 CTATGCTATGCACAGGAAAATGG + Intergenic
1124618824 15:31262410-31262432 GTGTGCTGTGGAGAGGAAGGAGG + Intergenic
1126192546 15:45893315-45893337 CTGTCCTCAGAAGAGGAAGGTGG + Intergenic
1127270649 15:57398454-57398476 CTGTTCTATTTGGAGGAAGAGGG + Intronic
1127377966 15:58402350-58402372 CTGGGACATGAAGAGGGAGATGG + Intronic
1128130515 15:65224223-65224245 CTCTGCTCAAAAGAGGAAGAAGG - Intergenic
1128421577 15:67496676-67496698 CTCTACTAAGAAGAAGAAGAAGG + Intronic
1128798905 15:70484610-70484632 CAGTGCTAGGGAGAGGTAGAGGG - Intergenic
1129159642 15:73740188-73740210 CTGTGCTGTGACGATGAGGAGGG - Exonic
1129522425 15:76194314-76194336 CTGAACGATGAAGATGAAGAAGG - Intronic
1131082520 15:89548591-89548613 CTGTGCTCTAGACAGGAAGAAGG - Intergenic
1133392223 16:5419817-5419839 CTGTGGTTTGAAGATGGAGAAGG + Intergenic
1136061360 16:27728847-27728869 CTGTGCTGTGCAGAGCAAGTGGG + Intronic
1138588570 16:57986893-57986915 CTGGGCTTTGAAGAGCATGAAGG - Intronic
1140720848 16:77770402-77770424 CTGTTCTAGGAAGAGGAGCAAGG + Intergenic
1140734993 16:77890561-77890583 GTGTACTATGAAGTGGCAGATGG - Intronic
1141385988 16:83623080-83623102 CTCTGCTAGGTAGAGTAAGAAGG + Intronic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142956150 17:3524112-3524134 CTGAGATCTGGAGAGGAAGAGGG - Intronic
1143251281 17:5525041-5525063 CTGTGGTCTGAAGGAGAAGAAGG + Intronic
1144336661 17:14277669-14277691 GTGTGCTATGAAGGGGCAGGGGG + Intergenic
1144386960 17:14756887-14756909 ATGTGCTAGGAAGAGAGAGAGGG + Intergenic
1145411492 17:22669862-22669884 CTGTGCAATGAAGGGAATGAGGG - Intergenic
1145970224 17:28951807-28951829 CTGTGTTATGGAGAGGAAGGGGG - Intronic
1147625191 17:41895627-41895649 CTGTGCTCTGAAGGGGAGGAGGG - Intronic
1147915446 17:43882798-43882820 GTGTGGTCTGAAGATGAAGATGG - Intronic
1148282797 17:46361930-46361952 CTGTGATTTGAAGATGAACATGG - Intergenic
1148305015 17:46579855-46579877 CTGTGATTTGAAGATGAACATGG - Intergenic
1148432619 17:47654502-47654524 TTGTGCTATGAAAGGGAAAAAGG - Intronic
1148498488 17:48070519-48070541 AGGTGTTAGGAAGAGGAAGAGGG - Exonic
1148720259 17:49747439-49747461 CTGGGCTATGGGGAGGAAGTTGG + Intronic
1149470004 17:56908753-56908775 CTGTCCTCTGAAAAGGATGAAGG - Intronic
1151617010 17:75219921-75219943 CTGTGCTATGTAGGGGTAGGTGG + Intronic
1151693883 17:75704193-75704215 CTGAGGTTTGAAGAGGCAGAGGG + Intronic
1152020763 17:77779180-77779202 CTCTGCCAGGAAGAGGCAGAAGG + Intergenic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1153367967 18:4280573-4280595 GTGTGGTAGGAAGAGAAAGAGGG - Intronic
1153647071 18:7204916-7204938 CTTTCCTGTGAGGAGGAAGAGGG + Intergenic
1155109141 18:22696891-22696913 CTGTGGTTGGAAGAGGCAGATGG - Intergenic
1157166636 18:45363647-45363669 CCGTGCTTAGAAGTGGAAGATGG + Intronic
1157762778 18:50276414-50276436 CTGTGCTGTGGGGAGGAAGAGGG + Exonic
1158093438 18:53742695-53742717 CCGTGATATGGAGAGAAAGATGG - Intergenic
1158279520 18:55806950-55806972 CAGTGCTATCAACAGAAAGAAGG - Intergenic
1158285169 18:55872822-55872844 CTGAGGTATGAAGAGTAAGCTGG - Intergenic
1158399259 18:57106122-57106144 CTCTGCTATGTGGAGAAAGAGGG + Intergenic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1159190561 18:65036303-65036325 CTGTGCAATGAAAGGGCAGAAGG - Intergenic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1161369013 19:3899098-3899120 CTTTGCCATGAACAGGAGGAGGG + Intronic
1161618397 19:5285367-5285389 CTGTAATGTGAAGAGGATGAGGG - Intronic
1162556955 19:11392984-11393006 CTGTGACAGGAAGAGGAAGAAGG + Intronic
1166352023 19:42203767-42203789 CTGTGCTGTGAAGTGGCAGGTGG + Intronic
924987382 2:284555-284577 CTGGGCCATGGAGAGGGAGAAGG - Intronic
927711052 2:25326501-25326523 CTGTGCTGTGAAGATGGAGCTGG + Intronic
927849519 2:26490020-26490042 CTGTGCTCAGAAGAGGCACAGGG + Intronic
928196102 2:29217862-29217884 ATGTGCCATGAAGAGAAAGTAGG - Intronic
929104119 2:38347217-38347239 CTCTGCTATGGAGAGGAGGCTGG - Intronic
929230474 2:39554924-39554946 CTGTACTCTGGAGAGGAAGGTGG - Intergenic
929670612 2:43874427-43874449 CTTTACTATGAACTGGAAGACGG + Exonic
930557558 2:52918301-52918323 CTCAGATATGAAGAGTAAGAGGG - Intergenic
931908608 2:66869914-66869936 CAGTGTTATGAATAGGAAGAAGG + Intergenic
932246784 2:70203011-70203033 CTGTGCTATAAAGAAGGGGAAGG + Intronic
932511408 2:72296376-72296398 GTGTGCTATGAAGAGGACAGTGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937281043 2:120717308-120717330 CTGAAATCTGAAGAGGAAGAGGG - Intergenic
937471960 2:122181760-122181782 CTCTTCTCTGAAGAGGAACAGGG - Intergenic
937705196 2:124912389-124912411 CTGTGCTAAGTAGAGGAATATGG + Intronic
943045890 2:182862038-182862060 GTGTGATATGAGGAGGAAAATGG - Intronic
944209748 2:197194859-197194881 CTGAGTTATAAAGATGAAGAAGG + Intronic
945340469 2:208646694-208646716 CTGTGATATGCAGGAGAAGAGGG - Intronic
945997346 2:216449071-216449093 CCATGTTATGAAGAGCAAGAAGG - Intronic
946501721 2:220255475-220255497 TTGTTTTATGAAGATGAAGATGG + Intergenic
946701189 2:222416011-222416033 ATGTCCTATGAAGAGAAAGTAGG - Intergenic
947050582 2:226038497-226038519 CTGGGGATTGAAGAGGAAGAAGG + Intergenic
947095877 2:226566360-226566382 GTGTGCTCTGAGGAGGGAGACGG - Intergenic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947451846 2:230215941-230215963 CTGTGATCTGAAGAGGGAGTTGG + Intronic
947591457 2:231388468-231388490 CTGTGCTCCGGAGAGGAAGCAGG + Intergenic
1169886767 20:10408273-10408295 CTCTGCTAAGAAGTGGATGATGG + Intronic
1170096385 20:12650262-12650284 CTGTGCCATCAAGAGAAACAGGG - Intergenic
1170223735 20:13967726-13967748 CTGTGAAATGAAGAGGGTGACGG + Intronic
1170521571 20:17191141-17191163 TTCTGCTTTAAAGAGGAAGAAGG - Intergenic
1170527771 20:17258215-17258237 CAGAGCTATGAAGAAGAGGATGG + Intronic
1170764379 20:19277462-19277484 CTGAGCTAGGAAGAGGCAGTTGG - Intronic
1170792519 20:19519711-19519733 CTGTGCCAAGTAAAGGAAGAAGG + Intronic
1171542763 20:25977159-25977181 CTGTGCAATGAAGGGAATGAGGG - Intergenic
1171798294 20:29583366-29583388 CTGTGCAATGAAGGGAATGAGGG + Intergenic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1173350422 20:42240094-42240116 CTGTGGTTTGAAGGTGAAGAAGG - Intronic
1174217373 20:48927084-48927106 TTGTGTTGTAAAGAGGAAGAAGG + Intronic
1174641037 20:52044387-52044409 CTGGGATATAAAGATGAAGAAGG + Intergenic
1174715392 20:52752269-52752291 CTGTGCTTTGGAGAGGAATTTGG + Intergenic
1175571065 20:60022759-60022781 ATCTGCTATGAAGAAGGAGAAGG + Intronic
1178252737 21:31020189-31020211 CTGAGCTCTTAAGAAGAAGAGGG - Intergenic
1179180577 21:39041578-39041600 GTGTGCTAGGAAAATGAAGAAGG - Intergenic
1179409899 21:41154379-41154401 CTGTGGTCTGAACAGCAAGAGGG + Intergenic
1180673341 22:17570273-17570295 CTCTGCTAATAAGAGGAAGTAGG + Intronic
1180746013 22:18089520-18089542 CTGTGCTGTCAGGATGAAGAAGG + Exonic
1181479196 22:23187131-23187153 ATGGGCTATGAAAAGGAGGAAGG - Intronic
1182265541 22:29112108-29112130 CTGGTCCACGAAGAGGAAGAAGG - Intronic
1182326420 22:29516675-29516697 CCCTGTTATGAAGAGGGAGAAGG + Intronic
1183856361 22:40637387-40637409 CTGGGCTTAGAAGAGGAAAAGGG + Intergenic
1185169488 22:49284396-49284418 CTGTTTTATTAAGTGGAAGAGGG + Intergenic
1185201843 22:49511712-49511734 CTGATCTATGAAGAGGAAGTGGG + Intronic
1185201859 22:49511822-49511844 CTGATCTATGAAGAGGAAGTGGG + Intronic
950457399 3:13100887-13100909 CAGTGCTGTGAAGATGAAGAGGG + Intergenic
951934282 3:28004051-28004073 ATGTGCTTTGAAGAGAAGGAAGG + Intergenic
951950756 3:28197973-28197995 GTTTGCTATGAAGGGAAAGAGGG + Intergenic
952725273 3:36577723-36577745 CTGGGCTGTGAAGAAGAAGGAGG + Intergenic
953049162 3:39324823-39324845 CTCTTCTATGCAGAGGAACAGGG + Intergenic
953811899 3:46119958-46119980 CTGATCTTTGAAGAGGAAGAGGG + Intergenic
954799396 3:53178503-53178525 CTGTGCCGTGAAGATGAAGGAGG + Exonic
954959761 3:54553828-54553850 CTGTCCTGGGAAGAGGAAGTAGG + Intronic
955882743 3:63565199-63565221 CTGTCCTATGGAGAGGGAGGAGG + Intronic
956571548 3:70702144-70702166 CTGTGCTCTGAAAATGAAAAAGG - Intergenic
958763316 3:98334364-98334386 CTCTGTTATGAAGAGGTACAAGG + Intergenic
958766375 3:98372814-98372836 ATGAACCATGAAGAGGAAGATGG - Intergenic
958850537 3:99319558-99319580 ATCTTCTAGGAAGAGGAAGAAGG - Intergenic
960459946 3:117921372-117921394 CTGAGCAATGAAGAGGGAAAGGG + Intergenic
961321416 3:126078916-126078938 TTTTGCCATGAAGAGGAGGAGGG - Intronic
961639442 3:128355852-128355874 CTGTGCTCTGAAGAGAGACAGGG + Intronic
961667619 3:128503535-128503557 CTGTACTATGAACAGAAAGTGGG - Intergenic
961816234 3:129551924-129551946 CTGTGCTCTGAAGAAGAGGTGGG + Intergenic
963466742 3:145691351-145691373 GTGAACTATAAAGAGGAAGAGGG - Intergenic
963849902 3:150200820-150200842 CTGAGCTATGGAAAGGAATAAGG - Intergenic
964168195 3:153734648-153734670 CTGTGCTATGAAGGAAAACATGG + Intergenic
964344353 3:155741035-155741057 CTGTGCTTCGTAGTGGAAGAGGG - Intronic
964412998 3:156418804-156418826 CTGTTCTATCTAGAGGATGAAGG + Intronic
964523374 3:157590946-157590968 CTCTGCTAAGAAGTGGCAGAGGG + Intronic
964620651 3:158717437-158717459 CTGAACTCTGAAGATGAAGAAGG + Intronic
964836606 3:160946177-160946199 CTGGGCTAAGAAAAGTAAGATGG - Intronic
966794346 3:183699032-183699054 GACTGCTATGTAGAGGAAGAGGG + Intronic
967244892 3:187476778-187476800 ATGTCCTATGAAGAGAAAGGAGG - Intergenic
970296690 4:14638534-14638556 CTGAACTCTGAAGAGGAAGAGGG - Intergenic
971219699 4:24693504-24693526 GTGTTCTATGAATGGGAAGAAGG - Intergenic
971282221 4:25250204-25250226 CCGTGCAAAGAAGAGGGAGAGGG + Intronic
973026426 4:45278543-45278565 ATGTGATATGAAGAGGAACATGG + Intergenic
973258770 4:48139848-48139870 CTTTGCTATGTAGACAAAGATGG + Intronic
973862387 4:55078048-55078070 CTTTGTAATGAAGAAGAAGAGGG + Intergenic
977743139 4:100511654-100511676 CTTTGAAATGAAAAGGAAGAAGG + Intronic
978070295 4:104458942-104458964 CATTGCTATGAAGACAAAGATGG - Intergenic
982078945 4:151768316-151768338 CTGTTCTATAATGAGGAAAATGG - Intergenic
984215499 4:176908980-176909002 CAGAGCTATTAAGAGGAAAAAGG - Intergenic
985815499 5:2125230-2125252 CTCTGATATGAAGTGGAAGAGGG + Intergenic
987524561 5:19030781-19030803 CTGAGTTGTGAGGAGGAAGAAGG - Intergenic
987991825 5:25222492-25222514 CTATGCTATTAAGTGGAACATGG - Intergenic
988410756 5:30882886-30882908 CAGTGATATGAAAAGGAAGGAGG - Intergenic
988990145 5:36662513-36662535 GTGTGCTAAGCAGAGCAAGAGGG - Intronic
991035940 5:62127452-62127474 CTGAGCCATGAAGAAAAAGAGGG - Intergenic
991094316 5:62723297-62723319 TTATGCCATGAAGTGGAAGATGG - Intergenic
992442158 5:76806446-76806468 GGGAGCTATGAAGAGGAGGATGG - Intergenic
992857214 5:80874535-80874557 CTGGACTTTGCAGAGGAAGAGGG - Intronic
993296529 5:86148080-86148102 CTCCCCTATGAAGAGGAAGGGGG - Intergenic
993719843 5:91311429-91311451 CTGTGCTAGGTAGGGGTAGAGGG - Intergenic
994070732 5:95599019-95599041 AAGTGCAATGAAGAAGAAGAAGG - Intronic
994581673 5:101650438-101650460 TTGTGCTATGAAGAAGGTGAGGG + Intergenic
995007753 5:107221346-107221368 GGGTGCTGTGAAGAGCAAGAAGG - Intergenic
995225878 5:109700434-109700456 CTGTGGTATGAAGAAACAGAAGG - Intronic
996555851 5:124778254-124778276 TTTGGCTATGAAGGGGAAGAGGG + Intergenic
999654960 5:153802338-153802360 TTGTCCTAAGAAGAGGAGGAGGG - Exonic
1001292161 5:170471484-170471506 CTGAGCTGTGAAAAGGGAGATGG - Intronic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002518892 5:179779359-179779381 CAGTGCTGTTAACAGGAAGAGGG + Intronic
1002690030 5:181044209-181044231 CTGGGCCATGCAGAGGCAGAAGG - Intronic
1002877682 6:1226106-1226128 CCTTGCTGTGAAAAGGAAGACGG + Intergenic
1004162555 6:13227832-13227854 CTGTGGTAAGAAGTGGAACAGGG - Exonic
1004701069 6:18080019-18080041 ATGTGCTAAGAAGATAAAGAAGG + Intergenic
1005150680 6:22746126-22746148 GTGTGCTTTGAAGAAGAAGGGGG + Intergenic
1005529934 6:26692940-26692962 CTGAGAAATGAAGATGAAGATGG - Intergenic
1005540862 6:26808707-26808729 CTGAGAAATGAAGATGAAGATGG + Intergenic
1005686236 6:28255528-28255550 CTGTGCCATGAAAAGAAAAAAGG - Intergenic
1005955076 6:30657884-30657906 CAGTGCTATGAAGAGATACAAGG - Intronic
1006688745 6:35861479-35861501 CACTGCTCTGAGGAGGAAGAGGG + Intronic
1007094388 6:39204437-39204459 ATGTGCTATGGAGAGGAGGTAGG - Intronic
1007371611 6:41429879-41429901 CTGTGGTTTGAAGAGGGAGAGGG - Intergenic
1007771259 6:44194301-44194323 CTCTCTTATTAAGAGGAAGATGG + Intergenic
1009011674 6:57850796-57850818 CTGAGAAATGAAGATGAAGATGG + Intergenic
1010097779 6:72067009-72067031 CTGTAGTATGAAGTGGAGGATGG - Intronic
1011688969 6:89848115-89848137 CTATGCCATGGAGAGTAAGAAGG + Intronic
1012035337 6:94130513-94130535 GTGGGCTAAGAAAAGGAAGATGG + Intergenic
1013093615 6:106923304-106923326 GTGTGCTATAAAGAGGAACTGGG - Intergenic
1013857711 6:114594304-114594326 CTCTTATAAGAAGAGGAAGAGGG + Intergenic
1014167891 6:118246301-118246323 CTGAGCCATGAAGAAAAAGAGGG - Intronic
1015196792 6:130532380-130532402 CTGTCCTATCACTAGGAAGAAGG + Intergenic
1015580998 6:134725156-134725178 CTGTCCTATAAACAGGATGAGGG - Intergenic
1016131933 6:140484666-140484688 CTGTGCCAGGAAGAGGAATTAGG - Intergenic
1016525369 6:144995916-144995938 CAGTGCTATGAATAGGAGAATGG - Intergenic
1016985047 6:149888820-149888842 CTGGGCCATGAAGATGAATAGGG + Intronic
1017225334 6:152014684-152014706 CTGTGCCATGCAGAGGAATGGGG - Intronic
1017280673 6:152620966-152620988 TTGTGCTATAAAGAGCTAGAGGG + Intronic
1018196001 6:161356529-161356551 CTGTGCTTGGAAGAGGAGGCGGG + Intronic
1019211319 6:170407650-170407672 CTGGGCTATAAAGAGTAACATGG - Intergenic
1019629582 7:2041187-2041209 CTGTGCTAGGAAGGGGAGGCAGG - Intronic
1021973263 7:25985352-25985374 CTGTGCAAAGAACAGAAAGAAGG - Intergenic
1022861170 7:34368559-34368581 CTTTGAAATGAAGAGGAAGATGG - Intergenic
1023082621 7:36539415-36539437 CTGAGCAAGGAAGAGGAACAGGG - Intronic
1023679049 7:42664838-42664860 CTGAGTTATGAATAGAAAGAAGG + Intergenic
1024505168 7:50156625-50156647 CTGGGATATGGAGAGGAGGAGGG - Intronic
1025187186 7:56870510-56870532 GTGGGCCATGGAGAGGAAGAAGG + Intergenic
1025684736 7:63706407-63706429 GTGGGCCATGGAGAGGAAGAAGG - Intergenic
1026261530 7:68759707-68759729 CTGTGTGATGCAGAGCAAGAAGG - Intergenic
1026778085 7:73244116-73244138 CTGTGCTCAGAAGTTGAAGATGG - Intergenic
1027018938 7:74797510-74797532 CTGTGCTCAGAAGTTGAAGATGG - Exonic
1027069092 7:75148427-75148449 CTGTGCTCAGAAGTTGAAGATGG + Exonic
1027548970 7:79567256-79567278 CTGTCATCTGAAGAGGAGGAGGG - Intergenic
1028620501 7:92821807-92821829 CTGTTCTAAGCAGAGGAGGAAGG + Intronic
1029945608 7:104529633-104529655 CTGTCTTATGTAGAGAAAGAGGG - Intronic
1030553653 7:110996241-110996263 CTAAGATATGAAGAGTAAGAAGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034929320 7:155149016-155149038 CTCTGCCAGGCAGAGGAAGATGG - Intergenic
1035488209 7:159247207-159247229 GTGTGTTATGAAGAAGAAAAAGG + Intergenic
1036720971 8:11174932-11174954 CTGTCCTAGAAAGAGGAAAAGGG - Intronic
1037297894 8:17420597-17420619 CTGGGCTATGCAGAGGATGCAGG - Intergenic
1037670764 8:21013338-21013360 CTGTGGTATGCAGAGGAGGGAGG + Intergenic
1038865634 8:31436176-31436198 CCATGCTAGGAAGGGGAAGAAGG - Intergenic
1041231872 8:55760483-55760505 CTGTTCTATGTGGAGGAATATGG - Intronic
1041499223 8:58521716-58521738 GTGTTCTATGCACAGGAAGAAGG - Intergenic
1041533241 8:58895719-58895741 CTGTGTTATGCAGAGAAAAATGG - Intronic
1041787930 8:61656534-61656556 CTGTGCTGCCAAGAGGAACAGGG + Intronic
1045201473 8:99986602-99986624 CTTTGCATTGAAGAGGAGGAAGG - Intronic
1045854304 8:106746104-106746126 CTGTGCTCTAAAGAAAAAGATGG - Intronic
1047222854 8:122932453-122932475 ATGTGCTTTGAAGATGGAGAAGG - Intronic
1049173445 8:141176489-141176511 CTCTGGAATGAAGAGGCAGATGG - Intronic
1049198896 8:141330315-141330337 TTGTGAGAAGAAGAGGAAGAGGG - Intergenic
1051213707 9:14773817-14773839 CTGTGCTATGGAGTGTAGGAAGG + Intronic
1051625298 9:19093454-19093476 CTGTGCTATGAAGAGGTCCTAGG - Intronic
1052203805 9:25813752-25813774 CTGTTATATGAAGTGGAAGGTGG - Intergenic
1052289362 9:26824277-26824299 CTGTGATATGGACAGGAAGCAGG - Intergenic
1052882399 9:33611125-33611147 CTGAGCTCTGAAGAGCAGGAGGG + Intergenic
1053145830 9:35711577-35711599 CTCCGGTATGAAGAGGCAGAGGG - Exonic
1053493886 9:38534284-38534306 CTGAGCTCTGAAGAGCAGGAGGG + Intergenic
1054162276 9:61682036-61682058 CTGTGCAATGAAGGGAATGAGGG + Intergenic
1056399070 9:86209485-86209507 CTGAGCTGTGAAGAGAGAGAAGG + Intergenic
1057674631 9:97129129-97129151 CTGAGCTCTGAAGAGCAGGAGGG + Intergenic
1057942644 9:99298347-99298369 CTTTGCTAAGCAGAGGAATATGG + Intergenic
1057968577 9:99530187-99530209 ATGTGCATTGTAGAGGAAGAGGG - Intergenic
1058079867 9:100690386-100690408 ATGTGCTTTGAAGATGGAGAAGG - Intergenic
1060167284 9:121428927-121428949 CCATGTTATGATGAGGAAGAAGG + Intergenic
1060767171 9:126303753-126303775 GGGTGCTAGGAAGAGGAAAATGG + Intergenic
1061602233 9:131678827-131678849 AGGTGCTCTGAGGAGGAAGAGGG - Intronic
1061970993 9:134045412-134045434 CTGTGTGTTGCAGAGGAAGATGG - Exonic
1186705278 X:12134133-12134155 CTGAGATATGAAGAACAAGAAGG - Intergenic
1187540571 X:20189269-20189291 CTGAGCTATAAAGATGAATAAGG - Intronic
1187817361 X:23247215-23247237 ATGTCCTATGAAGAGAAAGTAGG - Intergenic
1188242964 X:27811010-27811032 CTGGGATATCAAGTGGAAGAGGG + Intronic
1188465304 X:30472818-30472840 CTGTGTTATGAATAGGAAGTGGG - Intergenic
1188483918 X:30661666-30661688 CAGGGCTATGAAGAGGAGAAAGG - Intronic
1188960607 X:36486934-36486956 CTTTGCTATGAAGAAAAAGAAGG - Intergenic
1195253041 X:103066547-103066569 CTTTGGTATGAAGAGGATGGGGG - Intergenic
1195973248 X:110497051-110497073 ATGTGCTTTGAAAAGGAAGAAGG + Intergenic
1196938507 X:120753025-120753047 ATGTGCTGTGAAGAGGGAGGAGG + Intergenic
1197592501 X:128425722-128425744 TTTTGCTATGATGAGGAAGCTGG - Intergenic
1198820795 X:140646205-140646227 ATGTTGAATGAAGAGGAAGAAGG + Intergenic