ID: 920044946

View in Genome Browser
Species Human (GRCh38)
Location 1:203127111-203127133
Sequence ATGAAGAGGAAGAAGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3675
Summary {0: 1, 1: 2, 2: 50, 3: 501, 4: 3121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920044942_920044946 -1 Left 920044942 1:203127089-203127111 CCTTATGGCTTAGCGCTGTGCTA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG 0: 1
1: 2
2: 50
3: 501
4: 3121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920044946 Original CRISPR ATGAAGAGGAAGAAGGAGGA AGG Exonic
Too many off-targets to display for this crispr