ID: 920045816

View in Genome Browser
Species Human (GRCh38)
Location 1:203131673-203131695
Sequence CTGAGTTAGGGAAAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920045810_920045816 -2 Left 920045810 1:203131652-203131674 CCATGGAGAGGAGCCTTTCTCCT 0: 1
1: 0
2: 1
3: 30
4: 234
Right 920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 243
920045809_920045816 -1 Left 920045809 1:203131651-203131673 CCCATGGAGAGGAGCCTTTCTCC 0: 1
1: 0
2: 1
3: 18
4: 191
Right 920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 243
920045804_920045816 15 Left 920045804 1:203131635-203131657 CCTGGGAGTGTCCTGCCCCATGG 0: 1
1: 0
2: 0
3: 28
4: 267
Right 920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 243
920045807_920045816 4 Left 920045807 1:203131646-203131668 CCTGCCCCATGGAGAGGAGCCTT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 243
920045803_920045816 24 Left 920045803 1:203131626-203131648 CCAGCAGTGCCTGGGAGTGTCCT 0: 1
1: 0
2: 1
3: 28
4: 276
Right 920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 243
920045808_920045816 0 Left 920045808 1:203131650-203131672 CCCCATGGAGAGGAGCCTTTCTC 0: 1
1: 0
2: 4
3: 19
4: 276
Right 920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920045816 Original CRISPR CTGAGTTAGGGAAAGGCTGC TGG Intronic
900321754 1:2087949-2087971 CGGCGTGAGGGACAGGCTGCTGG + Intronic
905309166 1:37037578-37037600 CTGAGTAGGGGACAAGCTGCAGG + Intergenic
906203424 1:43974503-43974525 CTGGGTTAGGGAAGGCTTGCCGG + Intronic
906375268 1:45291585-45291607 CTTAGTTAGGGAAAATTTGCTGG - Intronic
908455840 1:64304115-64304137 GTGAGATAAGGAAAGGCAGCTGG + Intergenic
910080207 1:83332872-83332894 CTGAGTGAGGAAAAGGTTGTTGG - Intergenic
910239286 1:85069135-85069157 CAGAGTCAGGGAAAGACTACAGG - Intronic
910678062 1:89834843-89834865 ATGTGTTTGGGAAATGCTGCTGG + Intronic
912751233 1:112289563-112289585 CTAAGTTGGGGAAATTCTGCTGG - Intergenic
913410360 1:118544102-118544124 CTGGGTTAGGGAAATTCTCCTGG - Intergenic
913567329 1:120085550-120085572 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
913630805 1:120707996-120708018 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
914288077 1:146246256-146246278 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914422679 1:147543455-147543477 CTGAGTATGGGAAAAGCTGAAGG + Intronic
914549113 1:148697002-148697024 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914617569 1:149374717-149374739 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
915013537 1:152712444-152712466 ATGGGTTAGGGAAAGGGTGGTGG + Intergenic
915270602 1:154750746-154750768 CTGATTTAGGGCAAGCCTCCTGG - Intronic
916470347 1:165117484-165117506 CTGAGAGAGGGAACGGCTGGTGG + Intergenic
916747093 1:167693010-167693032 CTGAGATTCGGAAAGGCTGTTGG + Intronic
916798172 1:168187326-168187348 CTGACTTAGGAAAAGCCTCCTGG + Intronic
917791065 1:178499104-178499126 CTGAGCTGGGGTGAGGCTGCAGG - Intergenic
918235925 1:182580930-182580952 CTAAGTGAGGGAAAGGCTCATGG + Intronic
918402542 1:184178009-184178031 CTGATACAGGGAAAGGCTGTGGG - Intergenic
919131843 1:193460958-193460980 CTGAGAAATGGAAAGGCTCCTGG - Intergenic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920046235 1:203134397-203134419 CTGAATTAGGGATAGCCTTCAGG + Intronic
920956744 1:210626534-210626556 CTGAGTCAGGGAATGTCTGCTGG + Intronic
921026727 1:211290872-211290894 CTGAGTTAGGAAACTGCTGAAGG + Intronic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
923696965 1:236262842-236262864 CTCAGTTGTGGAAATGCTGCAGG + Intronic
924759430 1:246970420-246970442 CTGAGTTGAGGAAAGACTGGAGG + Intronic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1065831784 10:29621279-29621301 CTGAGCTAGGAAAGTGCTGCGGG + Intronic
1065989085 10:30990426-30990448 CTGAGTGAGGCTGAGGCTGCTGG - Intronic
1067570156 10:47365690-47365712 CTGAGAGAGGCAGAGGCTGCAGG + Exonic
1067793448 10:49304439-49304461 CAGAGTGAGGGACAGGTTGCAGG + Intronic
1068346374 10:55784491-55784513 CTGAGTGCTGGCAAGGCTGCAGG - Intergenic
1069024280 10:63522281-63522303 CTAAGTGATTGAAAGGCTGCAGG + Intronic
1069610491 10:69769406-69769428 CTGAGTCAGGGAAGGTCTGTGGG + Intergenic
1069774519 10:70918835-70918857 CTGGGTGACGGAGAGGCTGCAGG + Intergenic
1069774526 10:70918866-70918888 CTGGGTGACGGAGAGGCTGCAGG + Intergenic
1069774533 10:70918897-70918919 CTGGGTGACGGAGAGGCTGCAGG + Intergenic
1070595657 10:77831009-77831031 CAGAGTCAGGTCAAGGCTGCTGG + Intronic
1072813957 10:98486543-98486565 GTGAGTCAGGGAAAGGAGGCTGG + Intronic
1075894576 10:125983876-125983898 CTGAGTTGGGAACAGGCTGTAGG + Intronic
1076323467 10:129601503-129601525 ATGAGTAAGGGAAACACTGCAGG + Intronic
1076631495 10:131854836-131854858 CGGAGTTGGGGAGATGCTGCAGG - Intergenic
1077491947 11:2865041-2865063 ATGTGTTAGGGAAAGGCCCCAGG - Intergenic
1078461867 11:11520591-11520613 CTGAGGTAGAGAAGGGCAGCAGG + Intronic
1078537218 11:12184953-12184975 GTGAGTTAGGAAAAGGCCGATGG + Intronic
1079133872 11:17765071-17765093 CTGAGGCAGGGCAGGGCTGCGGG - Intronic
1079223052 11:18581321-18581343 CTAAGTTAGAGAAAGGCCTCTGG + Intronic
1081197472 11:40178850-40178872 CAGAGGAAGGGAAAGGCTACTGG - Intronic
1083767214 11:64847342-64847364 CGGAGATAGGGAAGGGCTCCTGG + Intergenic
1084424962 11:69079562-69079584 CTGAGTCAAGGACAGACTGCAGG - Intronic
1085973135 11:81618261-81618283 CTGAGAAAGGTAAAGGATGCAGG + Intergenic
1086521409 11:87672361-87672383 CTGGGGTAGGGGAAAGCTGCAGG - Intergenic
1089098935 11:115944198-115944220 CTGAGTTTGGAAAAGGATGTTGG + Intergenic
1089792688 11:120956032-120956054 CTGAGGTAGGCTAAGGCTGGAGG + Intronic
1090205014 11:124879281-124879303 CTGAGGTGGGGTGAGGCTGCAGG - Exonic
1090922579 11:131219366-131219388 CTGATTTAGGGAGAGGCAGGTGG + Intergenic
1093110314 12:15144160-15144182 CTGAGATAAAGAAAGACTGCAGG + Intronic
1093233377 12:16576174-16576196 CTGTGTTATAGAAAGGCTACCGG - Intronic
1095154055 12:38831305-38831327 CTGAATTGGTGAAAGGCTTCTGG - Intronic
1095852923 12:46830710-46830732 CTGGGCTAGGGAGAGTCTGCGGG + Intronic
1097204686 12:57310553-57310575 CTGGGTTAAAGGAAGGCTGCTGG - Intronic
1101302637 12:103496897-103496919 CTAAGTCAGAGAAAGGCTGTTGG - Intergenic
1101998827 12:109544150-109544172 CTGTGTCTGGGAAGGGCTGCAGG - Intergenic
1104369810 12:128214773-128214795 GTGTGTTTGGGAAACGCTGCTGG + Intergenic
1104758256 12:131282195-131282217 CCCAGTTAGGGCGAGGCTGCTGG - Intergenic
1105332711 13:19432911-19432933 CTGAGTTAGAGGAAGGCTTGTGG + Intronic
1105878976 13:24586866-24586888 CTGAGTTAGAGGAAGGCTTGTGG - Intergenic
1105920861 13:24962184-24962206 CTGAGTTAGAGGAAGGCTTGTGG + Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106862319 13:33923289-33923311 CTAAGTAAAGGAAAGGCTTCAGG - Intronic
1106901198 13:34356491-34356513 GTGAGTTGGGAAGAGGCTGCCGG - Intergenic
1107451335 13:40512778-40512800 CTGAAGAAGGGAAAGGGTGCAGG - Intergenic
1107540798 13:41387128-41387150 CTGAGTTGGGGAGAGGCACCTGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111987279 13:95077978-95078000 CTGGGTTGGGGAAAGGCAGATGG + Intronic
1113335293 13:109371048-109371070 CTGAGTTAGCGCAGGGCTGAGGG - Intergenic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1118321024 14:64753514-64753536 GTGAGTGCGGGAGAGGCTGCTGG - Intronic
1119732430 14:76959287-76959309 CTGAGCTAGAGACAGGATGCTGG + Intergenic
1121239259 14:92416243-92416265 CAGAGTGAGGGAGAGGCTGGTGG + Intronic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1123957960 15:25359804-25359826 CACAGTTTGGGAAAGGCTGATGG - Intronic
1126695113 15:51319172-51319194 CTGATTAAGGGAAAGGGTGTAGG - Intronic
1127076453 15:55331274-55331296 CTGAATTAGGGAAGGGCACCTGG - Intronic
1127799687 15:62467097-62467119 ATGAGTTACGGAATGGCTGTGGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128715401 15:69904216-69904238 CAGAATTAGGGAAGGGCTGCAGG + Intergenic
1131043286 15:89293271-89293293 CTGAGTAAGTGAAACCCTGCTGG - Intronic
1133078705 16:3300946-3300968 TTGAGTTAGGGAAAGTATGCAGG - Exonic
1134377317 16:13689348-13689370 CTCAGTTAGGGTAAGGGTGTTGG - Intergenic
1135544347 16:23355709-23355731 CTGTGTTAGGAAAAGTCTGCAGG + Intronic
1138223377 16:55272031-55272053 CTGTGTGGGGGATAGGCTGCAGG + Intergenic
1140271951 16:73474002-73474024 CTGAGATAGGAAATGGCTACTGG + Intergenic
1141643430 16:85354848-85354870 ATGACTCAGGGCAAGGCTGCAGG + Intergenic
1149988135 17:61363967-61363989 CAGAGTGAGAGCAAGGCTGCAGG - Intronic
1150207988 17:63423535-63423557 CTCTGTTAGGGAAGGGCTGCAGG + Exonic
1152664097 17:81557413-81557435 CAGAGTAAGGGAAATGCTGGTGG + Exonic
1152710286 17:81867878-81867900 CTGGGTCAGGGAAGGCCTGCCGG + Exonic
1153766556 18:8380328-8380350 CTGTGTTTGGCAAAGGATGCTGG - Exonic
1157208160 18:45718094-45718116 CTGAGTGAGAAAAAGACTGCAGG + Intergenic
1160901021 19:1428803-1428825 CTGGTTTAGGGCGAGGCTGCGGG - Intronic
1161801651 19:6419607-6419629 CTGAGCTACAGAAAGCCTGCTGG - Intronic
1162284434 19:9727633-9727655 CTGGCTTAGGGACAGGCAGCAGG + Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162679783 19:12332200-12332222 CTTAATTAGGGAAAGGCTAAAGG + Intronic
1163202787 19:15780390-15780412 CTGATTTAGGGAAAGGTCGTGGG + Intergenic
1163754025 19:19096010-19096032 CTGGGATAGGAAAAGGCTGGTGG + Intronic
1164651618 19:29894961-29894983 CTGAGTTAAGGAATGGGTGCAGG + Intergenic
1164812191 19:31166071-31166093 CTGAATTAGAAAAAAGCTGCTGG - Intergenic
1166750178 19:45160827-45160849 CAGGGATAGGGAAAGGCTGAGGG + Intronic
1167112181 19:47468991-47469013 GTGAGTTGGGGACAGGCTGTGGG - Intronic
1167763157 19:51462023-51462045 CTGTGGGAGGGAAAGGCTGTGGG - Intergenic
1168365575 19:55784187-55784209 CTTAGTTAGAGACAGGCTCCTGG - Intergenic
1168482486 19:56733400-56733422 CTGTGTTAGGGAAAGTGTGGGGG + Intergenic
1168659401 19:58154650-58154672 CTGAGCTCGGGAACGTCTGCTGG + Intronic
925143768 2:1567770-1567792 CAGAGTTCTGGAAAGGCTCCGGG - Intergenic
925185940 2:1846489-1846511 CTGGGGGAGGGAAAGGCTGGGGG + Intronic
925215296 2:2089376-2089398 CTGGGGTAGGGAATGGCTGGAGG + Intronic
926785621 2:16515828-16515850 CAGTGTTAGGGAAATACTGCTGG - Intergenic
926968317 2:18440558-18440580 CTGAGTTCGGGCAAGTCTGTGGG + Intergenic
927053418 2:19350593-19350615 CTGCGCTTGGGAAAGGCCGCGGG + Intergenic
927292569 2:21419679-21419701 CTGAGTTAGGGAAAAGTTATGGG - Intergenic
927369844 2:22341844-22341866 GTGAGTTTGGGAAAGGTTGAAGG - Intergenic
927856027 2:26528505-26528527 ATGAGTTGGGGACAGGCTGTGGG - Intronic
928813678 2:35261268-35261290 CAGAGTTGGGGATAGGCAGCAGG - Intergenic
929122843 2:38497540-38497562 CTGTGTTAGGAAGATGCTGCCGG + Intergenic
929505137 2:42522491-42522513 CTGGCTTAGGGAAAGGCTGGAGG + Intronic
929668814 2:43853470-43853492 CTGAGGAAGGGCATGGCTGCTGG + Intronic
929805777 2:45143702-45143724 CAGAGCTAGGGAGAGGCTGTTGG + Intergenic
930455897 2:51606833-51606855 ATGAGATAGGAAAAGGCTTCTGG + Intergenic
931230747 2:60372432-60372454 CTGAGCTAGGGAGAGTCAGCAGG - Intergenic
931974455 2:67628046-67628068 CTGCATTAAGGAAAGGCTGCTGG + Intergenic
932329379 2:70889071-70889093 CTGGGCTCGGGAAAGGCAGCGGG - Intergenic
932734098 2:74242203-74242225 CCCAGTTAGGGAAGGGCTGGTGG + Intronic
933346405 2:81091764-81091786 ATGATTCAGGGAAAGGCAGCAGG + Intergenic
933763574 2:85692412-85692434 CTGAGTTAGGGTAGGGCTGGGGG + Intronic
934502156 2:94870063-94870085 CTGGGTTAGGGTAAGTCTCCGGG + Intergenic
936289389 2:111208447-111208469 CTGAGTTAAGGAAAGCTTGTGGG + Intergenic
936849689 2:116880729-116880751 CTGAGTTAGCCAATGGCTACAGG - Intergenic
936948364 2:117951887-117951909 CAGAGTGGGGGAAGGGCTGCAGG - Intronic
942426372 2:175864685-175864707 TTGAGTGTGGGAAAGGCTGATGG + Intergenic
943683258 2:190789830-190789852 CTGATTTCAGGAAAGGCTGCAGG - Intergenic
944015067 2:195026297-195026319 CTGCTTTAGGGAAAGGCACCAGG - Intergenic
945193850 2:207219349-207219371 CTGGGTTAGGGAAGGGGTACGGG - Intergenic
945695935 2:213104845-213104867 CTGAGTATGGGAATGGCTGAAGG - Intronic
946050088 2:216855287-216855309 CTGAGTTTAGGAATGGCTGGAGG + Intergenic
946777454 2:223158306-223158328 CTGATTTTGGTAAAGGCAGCTGG + Intronic
948833464 2:240612463-240612485 CTGACTTGGCCAAAGGCTGCTGG + Intronic
1168893226 20:1307618-1307640 ATGAGTTAGGCAATGGCTGTTGG - Exonic
1169091588 20:2864284-2864306 CTGGGTGAGGGCAAGGCTGGGGG + Exonic
1170436896 20:16339640-16339662 CTGAGATGGGGAAAGGGAGCAGG - Intronic
1174061671 20:47837430-47837452 CAGAGGTAGGGACAGGCTGAAGG - Intergenic
1174069837 20:47891794-47891816 CAGAGGTAGGGACAGGCTGAAGG + Intergenic
1174074162 20:47920392-47920414 CTCAATAAGGGAAAGGCTGGGGG + Intergenic
1175565225 20:59970157-59970179 ATGAGTTTGGGAAAGGGTCCCGG - Exonic
1175800360 20:61797882-61797904 CTCAGGTAGGGCATGGCTGCAGG + Intronic
1179099087 21:38340819-38340841 CTCAGTTAGGGAAAGGCTGGAGG - Intergenic
1179626661 21:42653178-42653200 CCTAGTTAGGGGAAGGCTGTGGG + Intergenic
1180713776 22:17857909-17857931 CTGAGTTAGGGTGAAGATGCTGG + Intronic
1181622625 22:24101420-24101442 CAGAGTTATGCACAGGCTGCAGG - Intronic
1183097540 22:35562205-35562227 GTGACTTAGGGAAAGGCAGAGGG + Intergenic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1184655891 22:45941933-45941955 CTGAGGTAGGGTAGGGATGCAGG + Intronic
949376001 3:3391263-3391285 CTGAGATGGTGAAAGGATGCAGG - Intergenic
950439275 3:12999281-12999303 CTTAGATATGGAATGGCTGCTGG + Intronic
950850255 3:16055409-16055431 GTGATTTAGGGAGAGACTGCAGG + Intergenic
951345676 3:21544508-21544530 TTGAGTTAGGAAAAAGCTGAAGG + Intronic
953035564 3:39207507-39207529 CTGAGCTAGGGCAGGGCTTCTGG + Intergenic
954324770 3:49857557-49857579 CTGAGCTAGGGAGAGGGTGTAGG - Intergenic
954590175 3:51776330-51776352 CTCAGTAGGGGTAAGGCTGCTGG - Intergenic
955366863 3:58318228-58318250 CTTAGTTAGGGGAAGGGAGCAGG + Exonic
955804722 3:62722274-62722296 CTTGGTGAGGCAAAGGCTGCAGG + Intronic
959324407 3:104918735-104918757 TTGAGTTAGGGAAAGACTAAGGG + Intergenic
959902749 3:111678141-111678163 ATGACTTAGGCAAAGGCAGCAGG - Intronic
961481461 3:127183466-127183488 CTGAGCTGAGGACAGGCTGCAGG - Intergenic
962949188 3:140202471-140202493 CTGAGTTGGAGGAAGGATGCGGG + Intronic
963032813 3:140995721-140995743 CTGAGTCCCTGAAAGGCTGCTGG - Intergenic
964553053 3:157906421-157906443 CTGAGTTAGAGAAAGTCAGTAGG + Intergenic
967185759 3:186943243-186943265 TTGAGGCAGGGGAAGGCTGCAGG + Intronic
967390334 3:188948465-188948487 GTGCGGTAGGGAACGGCTGCTGG - Intronic
967922809 3:194625344-194625366 CAGAGGGAGGGAAGGGCTGCTGG - Intronic
969345003 4:6564588-6564610 CTCAGTTAGGGTGAGGCAGCTGG - Intergenic
972296233 4:37741742-37741764 CTGAGTGAAGGAAAGGCTGAAGG + Intergenic
978254021 4:106671676-106671698 CAGAGTTTGGAAAAGTCTGCAGG - Intergenic
979549361 4:121973503-121973525 CTGAATTAGTGAGAAGCTGCAGG - Intergenic
984172982 4:176383389-176383411 CTGAGAAAGGGAAATGATGCAGG + Intergenic
987045342 5:14102405-14102427 CTGCTTTAGGGATGGGCTGCTGG - Intergenic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
992181466 5:74202023-74202045 CTGGGTTGGTGACAGGCTGCTGG - Intergenic
995260834 5:110102793-110102815 CTGAGTTAGGAAAGGACTGTGGG + Intergenic
995869987 5:116734509-116734531 CTGAGTAAAGCACAGGCTGCTGG - Intergenic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
998524399 5:142829088-142829110 TTGAGTCAGGGAAAGGCTGGTGG + Intronic
998558630 5:143150095-143150117 CTGTGCCAGGGCAAGGCTGCTGG + Intronic
999980918 5:156957157-156957179 CTAAATTCGGGGAAGGCTGCAGG - Intronic
1000163448 5:158624079-158624101 CTATGTAAGGGAAAGGCAGCAGG - Intergenic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001198943 5:169698535-169698557 CTGAGTTAGTGATAGGCAGGTGG + Intronic
1002160929 5:177313677-177313699 GTGAGTTAAGGACAGGCGGCTGG - Intergenic
1002188499 5:177467120-177467142 CTGGGTTAGGGAGGGGCTGGAGG - Intronic
1002236662 5:177808160-177808182 CGGAGTTAGGGAGGGGCTGGTGG + Intergenic
1002310544 5:178311100-178311122 CTGAGCTAGGGGCTGGCTGCTGG + Intronic
1005041894 6:21607613-21607635 GTGTGTTGGGGAAAGGATGCAGG - Intergenic
1006105813 6:31715649-31715671 TGGAGGCAGGGAAAGGCTGCTGG - Intronic
1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006479898 6:34283689-34283711 CAGGGTTTGTGAAAGGCTGCTGG + Exonic
1007970110 6:46043460-46043482 GTGAGATAGAGAAAGGCTGGAGG + Intronic
1010715633 6:79226207-79226229 CTGTGTTTGAGAAAGGCTGCAGG + Intronic
1013305254 6:108841737-108841759 CAGGGTTAGGGAGAGGCTGGAGG - Intergenic
1013774977 6:113669629-113669651 AGGAGCTAGGGAAGGGCTGCAGG - Intergenic
1014138581 6:117916058-117916080 CTGAGTGAGCTAGAGGCTGCTGG + Intronic
1014410877 6:121118764-121118786 CTGACTTTGGGAAAGGAAGCAGG - Intronic
1015185592 6:130412317-130412339 CAGAGTGAGGCAAGGGCTGCAGG - Intronic
1016921610 6:149300559-149300581 CTGAATCAGGAAAAGGCTGAAGG - Intronic
1016981617 6:149860155-149860177 CGGAGACAGGGAAAGGCTGGGGG + Intronic
1017528396 6:155263365-155263387 CTGAGTTTGGAAAAGGCTGGCGG - Intronic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1019209479 6:170393813-170393835 CTGTGTTGGGGAAGGGCTGTAGG + Intronic
1020492593 7:8806866-8806888 ATGAGTTAGGGAGAGGGGGCGGG - Intergenic
1020660389 7:10974273-10974295 AAGACTTAGGGAGAGGCTGCAGG - Exonic
1022010865 7:26307203-26307225 CTGAGATAAGGAAAGGATACAGG - Intronic
1024189303 7:46989290-46989312 TTGTGTGAGGGACAGGCTGCAGG + Intergenic
1024620377 7:51151924-51151946 CTGAGTTAAGGAATGGCCACAGG - Intronic
1026602064 7:71785292-71785314 CTGTTTTCTGGAAAGGCTGCAGG - Exonic
1027641446 7:80738185-80738207 CTCAGTTAGCAAATGGCTGCTGG + Intergenic
1031564343 7:123276846-123276868 CTTAGTTGGGGAGAGGCAGCTGG - Intergenic
1033398581 7:140999893-140999915 TAGGGTTAGGGAAAGGCTCCAGG + Intergenic
1035731902 8:1859631-1859653 CTAAGTCAGGGAGAAGCTGCCGG - Intronic
1040372046 8:46786829-46786851 CTGAGTTAGGGAAATTCTCATGG + Intergenic
1041401056 8:57445871-57445893 CTGTTTTAGGGAATGGCTGAGGG - Intergenic
1043295929 8:78664049-78664071 CAGAATCAGGGAAAAGCTGCAGG + Intergenic
1043535158 8:81194948-81194970 CTGAGTTAAGGAAAGAATACAGG + Intergenic
1045516650 8:102865675-102865697 CTAAGTGAGAGAAAGGCTGCTGG + Intronic
1046334420 8:112766021-112766043 CTCAGTGAGGGAAAGGCTAAAGG - Intronic
1048016730 8:130503821-130503843 CCGAGATAGGAAAAGGCTGAGGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1051863226 9:21650393-21650415 CTAAGTTAGGGAAGGTCTCCTGG + Intergenic
1051912496 9:22170414-22170436 ATGAGTTTAGGAGAGGCTGCTGG + Intergenic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057524033 9:95783943-95783965 CACAGTTTGGGAAAGGCTGGTGG + Intergenic
1059391926 9:114004660-114004682 CTGGGTCAGGGCAGGGCTGCAGG - Intronic
1059671908 9:116499939-116499961 CTGAATCAGGTAAAGGCTGGTGG - Intronic
1060281855 9:122220395-122220417 CTGGGTGAGGGACACGCTGCAGG - Intronic
1060808833 9:126597601-126597623 CAGATTGAGGGAAATGCTGCTGG + Intergenic
1061014612 9:127974525-127974547 CTGAGTTAGGGAGAGCTTCCTGG - Intronic
1186133676 X:6496292-6496314 CTGAGTTGTGAATAGGCTGCCGG - Intergenic
1186368305 X:8919155-8919177 CTGAGTTTTGGAAGGGGTGCTGG + Intergenic
1186435397 X:9538800-9538822 CTTTGGTAGGGAAAGGCAGCTGG + Intronic
1189284434 X:39841283-39841305 GTGGGTTGGGGAAAGGCTGACGG + Intergenic
1190925835 X:54903273-54903295 CTGGGTAACTGAAAGGCTGCAGG - Intergenic
1191081608 X:56517164-56517186 CAGAGTTAAGGAAAGGTAGCAGG + Intergenic
1192585910 X:72317987-72318009 CTGAGTTTGGGAAAATGTGCAGG - Intergenic
1198087496 X:133294543-133294565 CTGACTTAGGTACAGGCTGATGG + Intergenic
1199100714 X:143796509-143796531 CTGAGTTTGGGCAAGGGTTCTGG + Intergenic
1199339429 X:146659568-146659590 CTGAAGTAGGGAAAGGCTTGGGG + Intergenic
1200127906 X:153825498-153825520 TTGAGTTAGGAAAAGGAAGCAGG - Intronic
1201499792 Y:14629358-14629380 CTGCGTTAGTGAAAGGGTGTTGG + Intronic