ID: 920047515

View in Genome Browser
Species Human (GRCh38)
Location 1:203142969-203142991
Sequence GGTCCCCTGGGGCCATAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920047502_920047515 25 Left 920047502 1:203142921-203142943 CCGCAATGCCCTGTTCTCTGTAA 0: 1
1: 0
2: 2
3: 16
4: 283
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047509_920047515 -9 Left 920047509 1:203142955-203142977 CCACTCACCATTACGGTCCCCTG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047503_920047515 17 Left 920047503 1:203142929-203142951 CCCTGTTCTCTGTAAACACAACA 0: 1
1: 0
2: 3
3: 26
4: 326
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047508_920047515 -8 Left 920047508 1:203142954-203142976 CCCACTCACCATTACGGTCCCCT 0: 1
1: 0
2: 1
3: 2
4: 56
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047507_920047515 -7 Left 920047507 1:203142953-203142975 CCCCACTCACCATTACGGTCCCC 0: 1
1: 0
2: 0
3: 5
4: 131
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047504_920047515 16 Left 920047504 1:203142930-203142952 CCTGTTCTCTGTAAACACAACAC 0: 1
1: 0
2: 0
3: 18
4: 190
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047506_920047515 -6 Left 920047506 1:203142952-203142974 CCCCCACTCACCATTACGGTCCC 0: 1
1: 0
2: 1
3: 3
4: 105
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109
920047501_920047515 29 Left 920047501 1:203142917-203142939 CCTGCCGCAATGCCCTGTTCTCT 0: 1
1: 0
2: 0
3: 6
4: 215
Right 920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920047515 Original CRISPR GGTCCCCTGGGGCCATAACT GGG Intronic
900114685 1:1023467-1023489 GGTCCCCTGGGTCCCCCACTGGG + Intronic
900577257 1:3389486-3389508 GGTCCCCTGGGGCCAGGAGGGGG - Intronic
900601352 1:3504094-3504116 CCTCCCCTGGGGCCATACCAGGG - Intronic
903820038 1:26094997-26095019 TGCCCCCTGGGGCCATCACGAGG - Intergenic
904860149 1:33531463-33531485 GTTCTCCTGGGGACATATCTAGG - Intronic
906059047 1:42936506-42936528 GGTCCCCTGGGGCCTCACTTTGG + Intronic
909201513 1:72695165-72695187 GGTCTCCTGGGGCTATATCATGG - Intergenic
915744322 1:158144424-158144446 GGTCCCCTGGGGTCCTGGCTGGG + Intergenic
919895934 1:202009985-202010007 GGGACCCTGGGGCCACGACTAGG + Exonic
920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG + Intronic
920785323 1:209035278-209035300 GGTCCCTTTGGGCCACAGCTGGG + Intergenic
923031621 1:230253390-230253412 GGGCACCTGTTGCCATAACTAGG + Intronic
924010909 1:239664611-239664633 AGTCCCCTGCGGCCATACCTGGG + Intronic
1065864642 10:29903524-29903546 GTTCTCCTGGGTCCATACCTGGG + Intergenic
1076180361 10:128402296-128402318 GGGCCCCTGGGGCCATGCCAGGG + Intergenic
1082239319 11:49854684-49854706 GGTACCCTGGGGCCAGCACAGGG + Intergenic
1083658523 11:64241658-64241680 GGACGCCCGGGGCCATTACTCGG - Intronic
1084406814 11:68979088-68979110 AGTCCCCTGGGTCCAGAACAAGG - Intergenic
1085385551 11:76155974-76155996 GGTCCCCTGCAGCTATCACTGGG - Intergenic
1085830551 11:79895988-79896010 GGTTCCCTTGAGCCATAGCTGGG + Intergenic
1090243067 11:125197559-125197581 GCTCTCCTGGGGCCTTAGCTGGG + Intronic
1094090496 12:26644237-26644259 GGTCCACTGGAGCCATACCTGGG - Intronic
1100703519 12:97175407-97175429 GGTCCCCAGCTGCCATAACAGGG + Intergenic
1104034557 12:125089358-125089380 GGACCCCTGGGGGCACACCTGGG + Intronic
1105330638 13:19412331-19412353 GTTCTCCTGGGGCCAGAAGTAGG + Intergenic
1107894819 13:44950772-44950794 GGTGTCCTGGGGCTACAACTAGG - Intronic
1107964862 13:45589208-45589230 GGTCCCCAGGGGCCAGATCTGGG - Intronic
1114742929 14:25116625-25116647 GGTCTCCTGGGGCTATATCATGG + Intergenic
1114989457 14:28269273-28269295 GGACCCCTTGGGCCAAGACTAGG - Intergenic
1117757692 14:58992556-58992578 GATCCCCTAGGGCCTTAACTAGG - Intergenic
1119101576 14:71884810-71884832 ATTTCCCTGGGGCCAGAACTAGG + Intergenic
1119981958 14:79091705-79091727 GGTCTCCTGGGGTACTAACTAGG - Intronic
1122868755 14:104624011-104624033 GGTTCCCTCGGGCCTTAACAAGG + Intergenic
1123067882 14:105627387-105627409 GGTCCGCTGGGGCCAGCCCTGGG + Intergenic
1123071901 14:105646112-105646134 GGTCCGCTGGGGCCAGCCCTGGG + Intergenic
1123097332 14:105772729-105772751 GGTCCGCTGGGGCCAGCCCTGGG + Intergenic
1127702482 15:61514681-61514703 GGTCCCCTGGGGCTTTCACTGGG - Intergenic
1129992578 15:79977810-79977832 GGTCCCATGGGGCCAAGCCTTGG + Intergenic
1132649486 16:1014111-1014133 GGTGTCCTGGGCCCACAACTCGG - Intergenic
1134055011 16:11164554-11164576 GCTTCCCTGGTGCCATAACCTGG + Intronic
1135745158 16:25010804-25010826 GGTCCCCTGAGGCCTTCACATGG + Intronic
1140250363 16:73289592-73289614 GGTGCCCTGGGGACATGGCTTGG - Intergenic
1140833221 16:78770455-78770477 GGTCCCCACGGGCCAGGACTGGG + Intronic
1141270239 16:82532996-82533018 GGTTACCTGGGGACAGAACTGGG - Intergenic
1141327469 16:83075270-83075292 GGTCCCCTGAGACAAGAACTGGG - Intronic
1143863606 17:9908462-9908484 GGTCCCCTGGGGCCCCTCCTGGG - Intergenic
1146549680 17:33769499-33769521 GGTCCCCTGTGTCCATTGCTGGG - Intronic
1147914965 17:43880624-43880646 GCTCCCCTGGGGCCAGGGCTGGG - Intronic
1149788993 17:59460941-59460963 GTTCACCTGGTGCCATTACTGGG + Intergenic
1150626889 17:66847701-66847723 TGTCTCCTAGGGCCATGACTGGG - Intronic
1151313756 17:73310066-73310088 GGGCTCCTGGGGCAATAACAGGG - Intronic
1152768845 17:82155432-82155454 GGTCCCCAAGGACCAGAACTAGG - Intronic
1158587790 18:58756350-58756372 GGACCTCTGGGGCCAGCACTAGG + Intergenic
1158851955 18:61503502-61503524 GGCCCCCTGGGGGCAAAAATAGG - Intronic
1161293689 19:3508762-3508784 TGTCCCCTGGGGACAGAATTGGG - Intronic
1162030010 19:7913271-7913293 GGTCTCCGGGGGCCACAGCTTGG + Exonic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162519722 19:11172719-11172741 GGTTCCCTGGGCCGAAAACTGGG - Intronic
1162958420 19:14112555-14112577 GGTCCCCTGAGGCCATCCCAAGG - Intronic
1163596968 19:18226012-18226034 GGTCCCCTGGGCCTATATCCAGG + Intronic
1166326547 19:42054344-42054366 GGTCCCGTGGGGCCAAATGTTGG + Exonic
1166826765 19:45614695-45614717 GGTCCCCTGGGGCAGAAAATGGG + Exonic
1167528709 19:50001508-50001530 GGTCGGCTGAGGCCATCACTGGG + Intronic
927492873 2:23532118-23532140 GCTCCACTGGGGCCATGCCTGGG + Intronic
937918273 2:127111315-127111337 TGTCCCCTGGGGCAATAGTTGGG + Intergenic
945734936 2:213587325-213587347 GGTCAGCTGGAGCCATACCTGGG + Intronic
1170994359 20:21337602-21337624 GCTCCCCTGGGCCCAGTACTTGG - Intronic
1172114120 20:32563534-32563556 GGTCCCCAAGGGCCATCACAGGG + Intronic
1173775914 20:45706156-45706178 GTTCCCCCTGGGCCATGACTTGG - Intronic
1174187563 20:48717424-48717446 AGTCCCCTGCGGCCATACCTAGG + Intronic
1175287295 20:57845370-57845392 TGTCCCCTGGGGCCATGGCCTGG + Intergenic
1176199800 20:63855114-63855136 GGTCCCCTGGGGTCAGCTCTGGG + Intergenic
1176236584 20:64056410-64056432 GGTCCACTGGGGTCACAGCTCGG + Intronic
1178674067 21:34615506-34615528 GGGCCCTTGGGGTGATAACTGGG + Intergenic
1181026261 22:20129515-20129537 GGTCCCGTGGGGCCAGCACGCGG - Intronic
1181364998 22:22369608-22369630 GGACCCCTGGTGCCAGAGCTGGG - Intergenic
1181368063 22:22395012-22395034 GGACCCCTGGCGCCAGAGCTGGG - Intergenic
1184682710 22:46080503-46080525 GGGCCCGTGGGCCCATAGCTGGG + Intronic
950499176 3:13353121-13353143 GGTCCCGTGGGGGCAGCACTGGG - Intronic
951576748 3:24122345-24122367 GGTCTCCTAGGAGCATAACTTGG - Exonic
952422722 3:33145909-33145931 GGTCCTCAGGGGACATCACTAGG - Exonic
953107256 3:39895731-39895753 GTTCACCTGGGGACATAAATGGG + Intronic
960673590 3:120174627-120174649 GGTCCCCAGTGTCCATCACTAGG - Intronic
962303803 3:134268129-134268151 GGTACCCTGGGGCAACCACTGGG - Intergenic
964069610 3:152615735-152615757 GGCCCCCTTTGGCCAAAACTCGG - Intergenic
966759907 3:183408468-183408490 GGTCCCTAGGGGCCAGAACCAGG - Intronic
977130241 4:93226943-93226965 GGTCCACTTGAGCCACAACTAGG + Intronic
983514678 4:168643674-168643696 GGTCACCTGCGGTCATAAATGGG - Intronic
985933894 5:3080075-3080097 GGGCCCCTGGGGCAAATACTGGG - Intergenic
989114647 5:37940551-37940573 GCTCACCTGAGGCCAAAACTTGG - Intergenic
992204873 5:74421514-74421536 GGTCCCCTGGAGCCCTAAGCTGG + Intergenic
993139634 5:84015114-84015136 GGTCCACTTGGGACATAACAGGG + Intronic
997977309 5:138448060-138448082 TGTCCCCTGGGGGCCTCACTGGG - Intergenic
1000860166 5:166448038-166448060 GGTCCACTTGGTCCAGAACTGGG + Intergenic
1001431018 5:171662344-171662366 GGTCCACTGTCTCCATAACTGGG + Intergenic
1003279461 6:4679114-4679136 GGCCTCCTGGGGCCACACCTGGG - Intergenic
1007666512 6:43516708-43516730 GGTGCCTTGGGGCCATTACCTGG + Exonic
1014752941 6:125273401-125273423 AGTCCCTTGGGGCCCAAACTTGG - Intronic
1015237105 6:130984161-130984183 GGTCCGCAGGGGCAATAACATGG + Intronic
1026499915 7:70935516-70935538 GGCCCCCTGGAGCCCCAACTTGG + Intergenic
1031919024 7:127588233-127588255 GGTCCCGTGCGGCCCTTACTTGG - Intronic
1033145643 7:138868396-138868418 AGTCCCATGGGGCTAGAACTAGG + Intronic
1034995703 7:155575935-155575957 GGTCGCCTGGGGACCTCACTTGG + Intergenic
1035264838 7:157685011-157685033 CGTCCCCCGGAGCCATACCTGGG + Intronic
1035987739 8:4453367-4453389 GGTCTCCTGGGCACAGAACTTGG + Intronic
1042162741 8:65913117-65913139 GCACCCCTGTGGCCATGACTGGG - Intergenic
1043911070 8:85864822-85864844 TGTGCCCTAGGGCCATAACCCGG + Intergenic
1046691567 8:117291351-117291373 GGTCCCCCGTGGCCACATCTGGG + Intergenic
1047205937 8:122802971-122802993 GGTCCCCTAGAGCGCTAACTGGG - Intronic
1057409258 9:94802361-94802383 GGTTCCCTCAGGCCAGAACTTGG - Intronic
1190077596 X:47329203-47329225 GGCTTCCTGGGGTCATAACTGGG - Intergenic
1190151495 X:47953890-47953912 GGTCACCTGTGGCCAGAAGTAGG + Intronic
1192632413 X:72787771-72787793 GGTTACGAGGGGCCATAACTTGG - Intronic
1192649296 X:72933030-72933052 GGTTACGAGGGGCCATAACTTGG + Intronic
1195338202 X:103877934-103877956 GTTTCCCTGGGACCATAACAAGG - Intergenic
1198104598 X:133450311-133450333 GGACCCCTTTGGCCAAAACTTGG - Intergenic