ID: 920049528

View in Genome Browser
Species Human (GRCh38)
Location 1:203154926-203154948
Sequence CAGAGAAAAAAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3761
Summary {0: 1, 1: 0, 2: 31, 3: 436, 4: 3293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920049528_920049533 8 Left 920049528 1:203154926-203154948 CCCTCTTCCTTCTTTTTTCTCTG 0: 1
1: 0
2: 31
3: 436
4: 3293
Right 920049533 1:203154957-203154979 GTCTTCGCTGGTTGGTCCCATGG 0: 1
1: 0
2: 1
3: 3
4: 72
920049528_920049532 0 Left 920049528 1:203154926-203154948 CCCTCTTCCTTCTTTTTTCTCTG 0: 1
1: 0
2: 31
3: 436
4: 3293
Right 920049532 1:203154949-203154971 TCAGATGTGTCTTCGCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 98
920049528_920049531 -4 Left 920049528 1:203154926-203154948 CCCTCTTCCTTCTTTTTTCTCTG 0: 1
1: 0
2: 31
3: 436
4: 3293
Right 920049531 1:203154945-203154967 TCTGTCAGATGTGTCTTCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 93
920049528_920049536 27 Left 920049528 1:203154926-203154948 CCCTCTTCCTTCTTTTTTCTCTG 0: 1
1: 0
2: 31
3: 436
4: 3293
Right 920049536 1:203154976-203154998 ATGGTGTGTTCACCATCTGATGG 0: 1
1: 1
2: 1
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920049528 Original CRISPR CAGAGAAAAAAGAAGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr