ID: 920050171

View in Genome Browser
Species Human (GRCh38)
Location 1:203159743-203159765
Sequence CCTATCAGGTGCCAGGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920050171_920050175 10 Left 920050171 1:203159743-203159765 CCTAGAACCTGGCACCTGATAGG 0: 1
1: 0
2: 5
3: 42
4: 298
Right 920050175 1:203159776-203159798 ATACCCCTTTAATAAATGAAAGG 0: 1
1: 0
2: 1
3: 23
4: 352
920050171_920050176 11 Left 920050171 1:203159743-203159765 CCTAGAACCTGGCACCTGATAGG 0: 1
1: 0
2: 5
3: 42
4: 298
Right 920050176 1:203159777-203159799 TACCCCTTTAATAAATGAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920050171 Original CRISPR CCTATCAGGTGCCAGGTTCT AGG (reversed) Intronic
902513347 1:16977726-16977748 CCTACCACGTGCCAAGTGCTGGG - Intronic
902757157 1:18556499-18556521 CCTATAATGTGCCAGTCTCTAGG + Intergenic
903033711 1:20481151-20481173 CCCATCAGCTCCCAGGTGCTGGG + Intergenic
903038268 1:20508756-20508778 CCTATTATGTGTCAGGTTCGAGG + Intergenic
903374204 1:22855504-22855526 CCCAGTAGGTGCCAGGTACTGGG - Intronic
903374434 1:22856993-22857015 CCTACCATGTGCCAAGTCCTGGG + Intronic
903392380 1:22973445-22973467 CTTACTAGGTGCCGGGTTCTGGG - Intergenic
903800427 1:25963190-25963212 CCTATTCCGTGCCAGGTTCCTGG - Intronic
904117863 1:28175642-28175664 CCTATCAGGTCCCAGGTGCTGGG - Intronic
904356796 1:29945481-29945503 CCTATTACGTGCCAGGTTCTGGG - Intergenic
904734334 1:32619136-32619158 ACTATGAGTTGACAGGTTCTTGG - Intronic
904773151 1:32892289-32892311 CCTGCCTGGTCCCAGGTTCTGGG + Intronic
905494795 1:38376391-38376413 CCAACCATGTGCCAGGCTCTGGG + Intergenic
905779124 1:40692155-40692177 CCAATAAGGTGCCAGGTCCGCGG - Intronic
905847723 1:41246673-41246695 CCTATTATGTGCCAGGAACTGGG + Intergenic
906804566 1:48767923-48767945 CCTACTATGTGCCAGGCTCTGGG + Intronic
907282514 1:53360391-53360413 AATATCCGGGGCCAGGTTCTGGG - Intergenic
907927020 1:58964693-58964715 CCTGTTAGGTGCCAGGCCCTGGG + Intergenic
911053594 1:93692834-93692856 CCTAGCAAGTGCCAGGCACTGGG - Intronic
915493229 1:156263349-156263371 CCTGTCAGGTCCCAGGGTCTTGG - Intronic
916059212 1:161087308-161087330 CCTACCAGGTGCCAGCTTCCTGG + Intronic
916439247 1:164806768-164806790 CCTACCAGGTTCCAGGCACTGGG - Intronic
918066170 1:181103315-181103337 CCTAGCATCTGCCAGGTTCTGGG - Intergenic
918126704 1:181590227-181590249 CCTTTAAGGTGCCAGGTACTAGG + Intronic
918256272 1:182751394-182751416 CCTATTAGGTGTCAGGTACCAGG + Intergenic
919781134 1:201221879-201221901 CCTACTAGGTGCTAGGTACTGGG + Intronic
920021388 1:202958751-202958773 CCTACCATGTGCCAGGCCCTGGG + Intergenic
920050171 1:203159743-203159765 CCTATCAGGTGCCAGGTTCTAGG - Intronic
920057098 1:203200806-203200828 CCTATTAGGTGCCAAGTCCTGGG + Intergenic
921052921 1:211523883-211523905 CCTATCATGGGCCAGGCTCTAGG - Intergenic
921585911 1:216946271-216946293 CCTATGAGGTGCCTGTTGCTTGG - Intronic
922422769 1:225470818-225470840 CCTACCATGTGCCAGGGGCTGGG - Intergenic
922478762 1:225924335-225924357 CCAATCAGTGGCCAGGATCTCGG + Intronic
922768912 1:228171459-228171481 CCTCACAGGACCCAGGTTCTGGG - Intronic
922980453 1:229821775-229821797 TCTATCATGTGCCAGGCCCTGGG - Intergenic
1063828554 10:9926126-9926148 CCTACTATGTGACAGGTTCTGGG - Intergenic
1066404499 10:35105792-35105814 TCTTTCAGGAGCCAGGTTCATGG - Intergenic
1066471440 10:35701798-35701820 CCCACCAGGTGCCATGTCCTGGG + Intergenic
1067968322 10:50940343-50940365 CTTACTAGGTGCCAGGCTCTGGG + Intergenic
1070123444 10:73600623-73600645 CCTATCAGGGGCCAGGCGCAGGG + Intronic
1070372955 10:75802686-75802708 CTTATTATGTGCCAGGTACTGGG - Intronic
1070549749 10:77481799-77481821 ACTAACAGGTGCCAGGTACTAGG + Intronic
1071494884 10:86161418-86161440 CCCACCTGGTGCCAGGCTCTGGG + Intronic
1071569912 10:86691181-86691203 CCTATCATGTGCCAGACCCTGGG + Intronic
1072177896 10:92947042-92947064 CCTATTATGTGCTAGGCTCTGGG - Intronic
1072222028 10:93334751-93334773 CCTACTATGTGCCAGGTACTAGG + Intronic
1072445864 10:95497894-95497916 CCTACTATGTGCCAGGCTCTGGG - Intronic
1072637632 10:97187798-97187820 CCTACTAAGTGCCAGGTGCTGGG - Intronic
1072807994 10:98437216-98437238 CCTACCATGTGCCAGTCTCTCGG - Intronic
1073078329 10:100838660-100838682 CCCATCAGCTGCCAGGCTCTTGG - Intergenic
1073470164 10:103717284-103717306 CTTACTAGGTGCCAGGTCCTGGG + Intronic
1073842584 10:107514731-107514753 CCTCTCCAGTGCTAGGTTCTGGG - Intergenic
1074273085 10:111974233-111974255 CTTATTATGTGTCAGGTTCTTGG + Intergenic
1074750124 10:116577844-116577866 CTTACCATGTGCCAGGTGCTAGG - Intergenic
1074834279 10:117274391-117274413 CCTATCATGTGCCCAGTCCTAGG + Intronic
1075065092 10:119283870-119283892 CCTATGACATGCCAGGCTCTGGG - Intronic
1075934549 10:126328227-126328249 CCTATTATGTGCCAGGTGCTAGG - Intronic
1078114487 11:8432070-8432092 CCTACCAGGTACTAGGTGCTAGG - Intronic
1078128896 11:8595177-8595199 CCTACTAGGTACCAGGCTCTAGG + Intergenic
1078753075 11:14183608-14183630 CCTACCATCTGCCAAGTTCTGGG + Intronic
1078907406 11:15700399-15700421 CCTAGCATGTTCCAGGCTCTGGG - Intergenic
1079689472 11:23403791-23403813 CCTTGCAGGTGGCAGGCTCTGGG - Intergenic
1080499831 11:32860090-32860112 CCTATCATGTGCCAGTTTCTAGG + Intergenic
1081756071 11:45545451-45545473 CCTATTATGTGCCAGGCACTGGG + Intergenic
1083252716 11:61478550-61478572 CCTACCGTGTGCCAGGTACTGGG + Intronic
1083399628 11:62414793-62414815 CCTTTCAGGTGCGAGGTTGGAGG - Intronic
1083718916 11:64594408-64594430 CCTACTATGTGCCAGGTGCTCGG - Intronic
1084087648 11:66861922-66861944 CCTAGCAGGCGCAAGGTTCTAGG + Intronic
1084145962 11:67265593-67265615 GTTGTCAGGTCCCAGGTTCTGGG + Intergenic
1085267581 11:75246419-75246441 CCTACTATGTGCCAGGGTCTGGG + Intergenic
1088297825 11:108319677-108319699 CCTATTATGTGCCAGGCACTAGG - Intronic
1089125475 11:116173547-116173569 CCTAACACGTGCCAGGTGTTGGG - Intergenic
1089636007 11:119812163-119812185 CCTACAAGGTGCCAGGCACTGGG + Intergenic
1089642980 11:119859760-119859782 CATATCAGGTGCCACCTCCTGGG - Intergenic
1091852952 12:3715119-3715141 CCTACCAGGTTCCAGGCACTGGG + Intronic
1092480419 12:8854426-8854448 CCTATGAGGTGCCGGGTTTTAGG - Intronic
1092513590 12:9184517-9184539 GCTAGCAGGTGCCAGGTTGCTGG - Intronic
1092981851 12:13803361-13803383 CCTGTCACATGCCAGGTACTGGG + Intronic
1093583429 12:20808514-20808536 TCTATAATGTGCCAGGTACTGGG + Intergenic
1093643264 12:21552960-21552982 CCCATCATGTGTCAGATTCTGGG + Intronic
1094709277 12:32945079-32945101 TTTATCAGGTGCCAGGTTCTGGG - Intergenic
1095721506 12:45406178-45406200 CCTGTCATATGCCAGGTACTGGG - Intronic
1095818009 12:46445971-46445993 CCTATTATGTGCCAGGTTCTAGG + Intergenic
1096640622 12:52991425-52991447 CCTACCATGTGCCCTGTTCTAGG - Intergenic
1098453065 12:70642162-70642184 CCTACATGGTGCCTGGTTCTCGG + Intronic
1100397076 12:94194828-94194850 CCTACCAGGAGCCAGGCACTGGG - Intronic
1100818055 12:98404819-98404841 GCTATTCAGTGCCAGGTTCTGGG - Intergenic
1100850353 12:98703744-98703766 CCTAACATGTGCCAGGAACTGGG + Intronic
1101019552 12:100539666-100539688 CCTATTATGTGCCAGGAACTGGG + Intronic
1102595552 12:113989759-113989781 CCAATCAGGTTGCAGGTGCTGGG + Intergenic
1102665626 12:114570234-114570256 CCTACCATGTGTCAGGCTCTGGG + Intergenic
1103253922 12:119523877-119523899 CCTGCCAGGTGCCAGGTGCTGGG + Intronic
1104423837 12:128658397-128658419 CCGCTCACGTGGCAGGTTCTGGG - Intronic
1106773268 13:32983594-32983616 CCTACCATGTGCCAGATACTGGG + Intergenic
1108075103 13:46671392-46671414 CCTATCAGGTGCCAGGCACCTGG - Intronic
1109149245 13:58823827-58823849 CCCAGCAGGTGCCAAGTGCTGGG + Intergenic
1110620026 13:77584980-77585002 CCTACTAGGTGCCAGGTACTTGG - Intronic
1112343707 13:98573596-98573618 ACTTTCATGTGCCAGGTCCTAGG - Intronic
1112457988 13:99579072-99579094 CCTAGTCGGGGCCAGGTTCTGGG + Intergenic
1112703734 13:102042138-102042160 CCTATCATGTGCTAGGTAGTAGG - Intronic
1113834523 13:113319918-113319940 TCTATCAGGGGCCAAGTTGTAGG - Intronic
1114700210 14:24670023-24670045 CCTACCATGTGCCAAGCTCTGGG - Intergenic
1116841796 14:49826243-49826265 CCTATCATATGCTTGGTTCTAGG + Intronic
1117211323 14:53503442-53503464 CCTACCATGTGCTAGGTACTAGG + Intergenic
1121333099 14:93060209-93060231 CCTCTCTGCTGCCAGGCTCTAGG + Intronic
1121827261 14:97020623-97020645 CCCACCATGTGCCAGGCTCTGGG - Intergenic
1122255995 14:100476921-100476943 CCTATTATGTGCCAGGAACTAGG + Intronic
1122689319 14:103524176-103524198 CCTAACAGGTGCCAGCCGCTGGG + Intergenic
1122887908 14:104718722-104718744 AATATCAGGTGCCCGCTTCTGGG - Intronic
1123064502 14:105610303-105610325 CCTAAAAGGTGCCAGACTCTTGG - Intergenic
1123073803 14:105655942-105655964 CCTAAAAGGTGCCAGACTCTTGG - Intergenic
1123087806 14:105725521-105725543 CCTAAAAGGTGCCAGACTCTTGG - Intergenic
1123093767 14:105754897-105754919 CCTAAAAGGTGCCAGACTCTTGG - Intergenic
1126323958 15:47455035-47455057 CTTACCATGTGCTAGGTTCTGGG - Intronic
1126446897 15:48757399-48757421 CTTATCATCTGCCAGGCTCTGGG - Intronic
1128242552 15:66110861-66110883 CCTAACAGGTGCCAGGATCAAGG - Intronic
1128249359 15:66153720-66153742 CCTATCACTTGCCATGCTCTGGG - Intronic
1129162875 15:73756790-73756812 CCTACCAGGTGCCAGGCACTGGG - Intergenic
1129230474 15:74194417-74194439 CTTAGTATGTGCCAGGTTCTAGG + Intronic
1129969993 15:79769686-79769708 CCTACCATGTGCCAGGCCCTTGG + Intergenic
1135170573 16:20179797-20179819 CCTATGATGTGCCTGGTGCTGGG - Intergenic
1135190739 16:20352431-20352453 CCTATTATGTGCCAGGTACCAGG - Intronic
1135543751 16:23352063-23352085 CTTACCATGTGCCAGGTGCTAGG - Intronic
1135664967 16:24328029-24328051 CCTACTATGTGCCAGGTCCTGGG + Intronic
1136076581 16:27821388-27821410 CCTATCAGGTACTATGTTCAGGG - Intronic
1137644550 16:50062779-50062801 ACTATCTTGTGCCAGGCTCTGGG + Intergenic
1137654310 16:50147025-50147047 ACTATTAGATGCCAGATTCTGGG - Intergenic
1137780832 16:51096498-51096520 CCTACTAAGTGCCAGGTACTAGG + Intergenic
1138683990 16:58708527-58708549 CCTCCCAGGTTCCAGGTTCCAGG - Intronic
1139408728 16:66741056-66741078 TGTACCAGGTACCAGGTTCTAGG - Intronic
1140451653 16:75075638-75075660 CCCATCATATGCCAGGCTCTAGG + Intronic
1140834110 16:78777712-78777734 CCTATTATGTGCCAGATACTAGG + Intronic
1141241211 16:82266791-82266813 CCTCTCAGATGCCAGCTTCCTGG - Intergenic
1141686040 16:85570566-85570588 CCTGTCACCTCCCAGGTTCTAGG + Intergenic
1144836045 17:18157239-18157261 CGTATGGGGTTCCAGGTTCTGGG - Intronic
1145248016 17:21282584-21282606 CCTACTATGTGCCTGGTTCTGGG + Intergenic
1147127281 17:38380244-38380266 CCTGTTAGATGCCAGGTACTTGG + Intronic
1147456835 17:40543133-40543155 CCTATGATGTGCCAGGCACTGGG + Intergenic
1147466379 17:40614391-40614413 CCCATCATGAGCCAGGCTCTGGG + Intergenic
1148213229 17:45820505-45820527 CTTAGAAGGTGACAGGTTCTGGG + Intronic
1148472208 17:47901883-47901905 CCTACCATGTGCCAGGGACTGGG + Intronic
1149092990 17:52806262-52806284 CCCATGAGGTACCTGGTTCTGGG - Intergenic
1149353565 17:55816413-55816435 CCTACTAGGTACCAGGTTTTTGG - Intronic
1149553304 17:57555706-57555728 CCTATTATGTCCCAGGTACTGGG - Intronic
1151820430 17:76493975-76493997 CCTATCCGGCCCCAGGCTCTGGG + Intronic
1154219367 18:12438617-12438639 CCTGTCAGGTGAGAGGTTGTGGG + Intergenic
1155384226 18:25259674-25259696 CCTACCATGTGCCAGGCACTGGG + Intronic
1156686353 18:39651696-39651718 CCTATTACATGCCAGATTCTGGG - Intergenic
1157151665 18:45224391-45224413 CCAATCAGGTGCCAGGTTGGAGG + Intronic
1157346026 18:46834076-46834098 CCTATCATGTGTCAGATACTAGG - Intronic
1157406055 18:47423604-47423626 CCTCTCAGGTGGCCTGTTCTTGG + Intergenic
1157448955 18:47771494-47771516 CCTATCATGTGCCAGGCTGTGGG + Intergenic
1157584408 18:48791947-48791969 CCTACCACGTGCCAGGCCCTGGG + Intronic
1157599267 18:48884224-48884246 CCTATTTGGTGCCAGGTGCCAGG + Intergenic
1157602739 18:48904114-48904136 CCTATTAAGTGCCATGTCCTAGG - Intergenic
1161920377 19:7261326-7261348 CCTACTAGGTGTCATGTTCTGGG - Intronic
1163695058 19:18759881-18759903 CCCATCAGGTGCCGTGTGCTTGG - Intronic
1165457895 19:35925352-35925374 CCTGCCATGTGCCAGGCTCTAGG - Intergenic
1165540624 19:36490167-36490189 CCCATCAGGTCGCAGGTTCCTGG - Intergenic
1165756462 19:38296126-38296148 CTCCTCAGGTGCCAGGTTGTTGG - Intronic
1166374503 19:42320072-42320094 CTTATCAGATGCCAGGATTTGGG + Intronic
1168093553 19:54101503-54101525 CCTATTATGTGCCAGGCTCTTGG + Intronic
926125150 2:10267510-10267532 CTTATCAGGTGCCAAGTGCTGGG + Intergenic
926185703 2:10689383-10689405 CCTATCATTTGCCAGGTCTTAGG - Intronic
926563023 2:14438477-14438499 CCTTCCAGATGCCAGATTCTGGG - Intergenic
926627247 2:15102452-15102474 CTTAACAAGTGCCAGGTACTGGG + Intergenic
926695362 2:15766884-15766906 TCTCTCAGGGGCCAGGTTCCAGG - Intergenic
927146527 2:20169773-20169795 CCTTTCACATGCCAGGTACTCGG - Intergenic
927652988 2:24923405-24923427 TCTACTAGGTGCCAGGTACTGGG - Intergenic
928268581 2:29833582-29833604 CTTACCAGGTGCCAGGCACTGGG + Intronic
928831611 2:35492604-35492626 CCTATCAAGTGACAGGTTTGTGG - Intergenic
929841226 2:45466014-45466036 TCTACCATGTGCCAGGTCCTGGG + Intronic
931259605 2:60605761-60605783 CCTATGATGTGCCAGCTTCTGGG + Intergenic
936686525 2:114833766-114833788 CTTATCACGTGCCAGGCTTTGGG - Intronic
937511148 2:122596218-122596240 CCTATTTTGTGCCAGGTTCTAGG + Intergenic
937530961 2:122827107-122827129 GCTATGAGAGGCCAGGTTCTGGG + Intergenic
938925956 2:136042663-136042685 CATATGATGTTCCAGGTTCTGGG + Intergenic
939335695 2:140825399-140825421 CCTATAATGTGCCAGTTACTGGG - Intronic
940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG + Intergenic
940812357 2:158259399-158259421 TCTATCAGGTGCCGGGTGGTAGG - Intronic
940970108 2:159886941-159886963 CATATTATTTGCCAGGTTCTAGG + Intronic
942082483 2:172413773-172413795 CCTATAGAGTCCCAGGTTCTGGG + Intergenic
942810315 2:179991744-179991766 CCTAGTAGGTGGCAGATTCTGGG - Intronic
946239345 2:218344503-218344525 CCTCTCCCGGGCCAGGTTCTCGG - Exonic
947634531 2:231673350-231673372 CCTTTCAGGGACCAGGTTCTGGG - Intergenic
947962315 2:234249564-234249586 CCTCCCTGGTGCCAAGTTCTTGG + Intergenic
948141807 2:235678802-235678824 CCTGTCAGCTGCAAGGTGCTGGG + Intronic
948237314 2:236400710-236400732 CCCATCAGGTGCCAGAGTCAGGG - Intronic
948854302 2:240722915-240722937 CATCTCACGCGCCAGGTTCTGGG + Intronic
1171422797 20:25030133-25030155 CAAGGCAGGTGCCAGGTTCTAGG - Intronic
1172017611 20:31887385-31887407 CTTACCATGTGCCAGGCTCTGGG + Intronic
1172701828 20:36858030-36858052 CCTGTCATGGGCCAGGCTCTAGG - Intronic
1172885568 20:38228610-38228632 CCAATCAGAAGCCAGGCTCTGGG - Intronic
1172964172 20:38821560-38821582 CCTTCCAAGTGCCAGGGTCTAGG - Intronic
1173174282 20:40752562-40752584 TATATCAGGAGCCAGATTCTGGG + Intergenic
1173821712 20:46023857-46023879 CCTACTAAGTGCCAGGCTCTGGG - Intronic
1174416426 20:50370142-50370164 CCTACTAGGTGCCAGGCCCTGGG - Intergenic
1174576943 20:51543256-51543278 CCTACCACGTGCCAGGTGCTGGG + Intronic
1175192505 20:57221064-57221086 CCTACTATGTGCCAGGCTCTAGG + Intronic
1175342210 20:58240181-58240203 GGTCTCAGGTGCTAGGTTCTTGG - Intergenic
1175438923 20:58977105-58977127 CCTACTAGGTGTCAGGTGCTGGG - Intergenic
1175546102 20:59778755-59778777 ACTAACAGGTGCCAGGTCCAGGG + Intronic
1176018720 20:62952083-62952105 CCCATCACAGGCCAGGTTCTGGG - Intergenic
1176587551 21:8603512-8603534 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1178739485 21:35184832-35184854 CTTATCTTGTGCCAGTTTCTAGG + Intronic
1180200882 21:46223382-46223404 CCTGTCCCGTGCCAGGCTCTGGG - Intronic
1180270381 22:10580510-10580532 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1180977384 22:19855691-19855713 CCTATCTTGTCCCAGGATCTGGG - Intergenic
1181764006 22:25078201-25078223 CCTATTATGTGCCAGGCACTGGG - Intronic
1182357388 22:29728449-29728471 TCTACCAAGTGCCAGGCTCTGGG - Intronic
1182573971 22:31260299-31260321 CCTTTCAGGTGTCAGGTTTCAGG + Intronic
1182689622 22:32149556-32149578 CCCATCAGCAGCCAGGTTCTAGG - Exonic
1183099402 22:35574700-35574722 CCTACTATGTGCCAGGTTCTAGG - Intergenic
1183261210 22:36797109-36797131 TCTTTTTGGTGCCAGGTTCTGGG + Intergenic
1183379635 22:37484480-37484502 CCAACCAGGAGCAAGGTTCTAGG + Intronic
1184094699 22:42310298-42310320 CCTACTATGTGCCAGGTCCTGGG + Intronic
1184095051 22:42311882-42311904 CCTTTCAAGTCCCAGCTTCTGGG - Intronic
1184097926 22:42326547-42326569 GCTGACAGATGCCAGGTTCTGGG + Intronic
1184372581 22:44091988-44092010 CCCATCACGTGCCATGCTCTGGG + Intronic
1184429878 22:44436196-44436218 CCTACTAAGTGCCAGGCTCTGGG - Intergenic
1185102272 22:48847445-48847467 CCTATCAGGTGATAGCTTCTTGG + Intronic
949139803 3:618239-618261 CCTAGCAGGTTCCAGCTACTAGG + Intergenic
950062629 3:10084668-10084690 CCTATTAGGTGTCAGGTTTTTGG - Intronic
950260180 3:11537723-11537745 CCTGCTCGGTGCCAGGTTCTGGG + Intronic
950847714 3:16031042-16031064 TCTATCAAGTGCCAGCTTCTAGG - Intergenic
951732282 3:25823652-25823674 CCAGGCAGGTGCCATGTTCTAGG + Intergenic
951940978 3:28078719-28078741 CTTATCATGGGCCAGGTGCTTGG + Intergenic
952328374 3:32341281-32341303 CTTCTCACGTGCAAGGTTCTGGG - Intronic
953162771 3:40436774-40436796 CCCATCAACTCCCAGGTTCTAGG + Intergenic
954893613 3:53956072-53956094 CCTACCATGTGCCAGGCACTGGG - Intergenic
955149151 3:56349617-56349639 CCTATCAGGGGCCAGGCGCGTGG + Intronic
956311445 3:67885065-67885087 CCTTTCAGGTTCCACGTCCTCGG - Intergenic
960006442 3:112786121-112786143 CTTATCAGGTGCCAGCCTCAAGG + Intronic
961438485 3:126936077-126936099 CCTAACAGGTGCCTGCATCTGGG + Intronic
961722027 3:128903250-128903272 CCTCTTTGGTGCCAGGCTCTGGG + Intronic
963232832 3:142926215-142926237 CCTATCATGTGCCAGGCACTAGG + Intergenic
964148474 3:153495148-153495170 TTTATCATGTGCCAGGCTCTGGG - Intronic
966298213 3:178448716-178448738 CCTACTATGTGCCAGGTACTAGG + Intronic
968654039 4:1771044-1771066 CCTCTCAGGTCCCAGGGTCAGGG - Intergenic
969486282 4:7474135-7474157 CTGAGCAGGTGCCAGGCTCTGGG - Intronic
970487828 4:16542195-16542217 CCTACCAGGTTCCAGGCACTTGG + Intronic
970505247 4:16722730-16722752 CCTATCATGTTACAGCTTCTTGG - Intronic
973728904 4:53804329-53804351 CCTACCATGTGCCAAGTACTAGG + Intronic
977207925 4:94184398-94184420 CCTCTTATGTGCCAGGTACTGGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
978760804 4:112355435-112355457 GCTATCAGGATCCAGGTTCTGGG + Intronic
980088479 4:128416636-128416658 CCTCTCCAGTCCCAGGTTCTGGG - Intergenic
983049388 4:163027723-163027745 ACTGTTAGATGCCAGGTTCTGGG + Intergenic
983798601 4:171898669-171898691 CCTATCAGTTGCCTGGATCTGGG + Intronic
984262237 4:177455919-177455941 GCCATCTGGTGCCTGGTTCTAGG + Intergenic
985531526 5:436472-436494 CCTCTCAGTGGCCTGGTTCTTGG + Exonic
985612061 5:895098-895120 GCTGTCAGGAGCCAGGTGCTGGG + Intronic
985925283 5:3011285-3011307 CCTCTCAGGTGCCCGGCTCAGGG + Intergenic
986196517 5:5541464-5541486 CTTATCAGGTGCTGGCTTCTGGG + Intergenic
986729671 5:10626007-10626029 CCTCTCGGGTTCCAGCTTCTTGG - Intronic
986729682 5:10626061-10626083 CCTCTCGGGTTCCAGCTTCTTGG - Intronic
987852236 5:23371104-23371126 CCACTCATGTGTCAGGTTCTTGG - Intergenic
990297142 5:54413663-54413685 TTTATCATGTGCCAGGTACTGGG - Intergenic
991621018 5:68545495-68545517 CCTTTCAGTTTTCAGGTTCTTGG + Intergenic
993874619 5:93292035-93292057 TCTACCAGGGGCCAGGTTTTGGG + Intergenic
994977321 5:106826680-106826702 CATATCAGGTCACAGATTCTTGG - Intergenic
996175053 5:120346205-120346227 CCTTTCAGGTGCCAGTGACTTGG - Intergenic
996302778 5:122008082-122008104 CCTGTCAGGTCCCAGGCTCCAGG - Intronic
997399177 5:133589311-133589333 CCTTTCAGAAGCAAGGTTCTGGG - Intronic
998430140 5:142063548-142063570 CCTATGATGTGCCAGGCACTAGG - Intergenic
999241876 5:150132623-150132645 CATATTAGGTGCCAGGTGCTGGG - Intronic
999269272 5:150286895-150286917 CCTGTCATGTGCCAGGCTCGAGG + Intronic
999885156 5:155914371-155914393 CCTACTATGTGCCAGGCTCTAGG + Intronic
1000584934 5:163085811-163085833 CCTACCTTGTGCCAGGTACTGGG - Intergenic
1000850904 5:166339395-166339417 CCTACTTTGTGCCAGGTTCTGGG + Intergenic
1001003250 5:168027549-168027571 GCTTTCTGGTGCCATGTTCTGGG + Intronic
1001434973 5:171693245-171693267 CCTACCATATGCCAGGCTCTGGG - Intergenic
1001587484 5:172843384-172843406 CATGTGAGGTGCCAGGCTCTGGG - Intronic
1001993340 5:176134704-176134726 CCCACCAGGTTCCAGGTTCCTGG - Intergenic
1003123536 6:3337369-3337391 CCTTGTAGGTGCCAGGTACTGGG + Intronic
1003748904 6:9033734-9033756 TTTATCAGGTGCGAGGTTCTGGG + Intergenic
1004083342 6:12418485-12418507 CCTATTAGGTGCCTGGTACATGG - Intergenic
1006131833 6:31874251-31874273 CCTACTATGTGCCAGGTGCTGGG - Intronic
1007509516 6:42364469-42364491 CCTACTATGTGCCAGGCTCTGGG - Intronic
1007960768 6:45957005-45957027 CTTGACAGGTACCAGGTTCTCGG + Intronic
1007965675 6:46001608-46001630 CCTACCAGGTGCCAGGCCCTGGG - Intronic
1011606229 6:89109043-89109065 CCTACCATGTGCCAGGCTCTAGG + Intronic
1013287575 6:108694086-108694108 CCTATCAAGTGACAGGCACTGGG + Intergenic
1013656927 6:112255586-112255608 CCTAACATGTGCCAGATACTTGG + Intergenic
1013967907 6:115977584-115977606 TCTAATAGGTGCCAGGTCCTAGG + Intronic
1014961440 6:127691078-127691100 CCTTTCAAGTGCCAGGCACTGGG + Intergenic
1017943478 6:159074478-159074500 AGTATCATGTGACAGGTTCTGGG - Intergenic
1018623648 6:165755960-165755982 CCTGTCTGGTGGCAGGTTCCCGG + Intronic
1021544260 7:21795534-21795556 CCTCTCATGTGTCAGGTGCTAGG - Intronic
1022110428 7:27226772-27226794 GCTGTCAGCTTCCAGGTTCTGGG + Intergenic
1023059472 7:36314330-36314352 GCCATGATGTGCCAGGTTCTGGG - Intergenic
1023241911 7:38157701-38157723 CCTTTGAAGTGCCAGTTTCTGGG - Intergenic
1024017374 7:45329325-45329347 CCTAACATCTGCCAGGTTCTGGG + Intergenic
1024354467 7:48400279-48400301 CCTAGCAGGTGGCAGGTGCCAGG + Intronic
1025102676 7:56149309-56149331 CTTATCATGAGCCAGATTCTGGG + Intergenic
1025869934 7:65422186-65422208 CCTATAAGGTGCCATGGTATTGG - Intergenic
1026284042 7:68947597-68947619 CCTATCATGTACCATGTACTTGG - Intergenic
1028511012 7:91626422-91626444 CCTATCAAGGACCATGTTCTTGG - Intergenic
1029210997 7:98908275-98908297 CCTGTCATGTGCCAGATCCTGGG - Intronic
1031402271 7:121339457-121339479 ACTCTCAGGTCCAAGGTTCTAGG - Exonic
1031814782 7:126420342-126420364 CCTATCAGGTGAATGGTTCCTGG + Intergenic
1032453599 7:132055285-132055307 CCTATCATGTGGCAGAATCTAGG - Intergenic
1035271574 7:157722905-157722927 CCTACCAGGTGCCAGGAACAGGG - Intronic
1036116514 8:5966020-5966042 CCTATCAGATGCCAGTTGCAAGG - Intergenic
1036176777 8:6546727-6546749 CCTACCAAGTGCAAGCTTCTAGG - Intronic
1037493098 8:19413897-19413919 GGTACCATGTGCCAGGTTCTGGG + Intronic
1038434221 8:27523372-27523394 GCTATCAGATGGCAGGTTTTGGG + Intronic
1038729469 8:30114201-30114223 CCAAGCAGATGGCAGGTTCTGGG - Intronic
1041198374 8:55424722-55424744 CCTAACACGTGCCAGGTTCAAGG - Intronic
1042206121 8:66331608-66331630 CCTATCAGGAGCCAAGCCCTGGG - Intergenic
1044366056 8:91347091-91347113 CCTACCACATGCCAGGTCCTGGG - Intronic
1044836218 8:96297976-96297998 CCTGGAAGGTACCAGGTTCTGGG - Intronic
1045760529 8:105601277-105601299 CCTACCATGTGCCAGCTACTGGG - Intronic
1049212534 8:141393308-141393330 CCACTCAGGTGACAGGTTCGGGG - Intronic
1050432239 9:5573747-5573769 CCTATCACGTACCAGGTACATGG - Intergenic
1050455037 9:5826455-5826477 CCTACCAGGTGCTAGGCACTGGG - Intronic
1054628941 9:67426253-67426275 CCTTTTAGGTGACAGATTCTTGG + Intergenic
1055317376 9:75047701-75047723 CCCACCAGGTGCCAGGCACTTGG + Intergenic
1056706403 9:88955716-88955738 CTTAGCAGGTGTCAGGGTCTGGG - Intergenic
1057829748 9:98397366-98397388 CCCATTACGTGCCAGGCTCTGGG + Intronic
1057868011 9:98696627-98696649 CCTACTTGGTGCCAGGCTCTGGG - Intronic
1058613451 9:106800291-106800313 CCTACTGTGTGCCAGGTTCTGGG + Intergenic
1058861790 9:109123570-109123592 CCTATGCTGTGCCAGGTGCTGGG - Intergenic
1058945537 9:109852209-109852231 CCTATCAGGTACTATGTTCATGG - Intronic
1059463405 9:114449848-114449870 CTTATCATGTGCCAGGCACTGGG + Intronic
1059702465 9:116788900-116788922 CTTATTATGTGACAGGTTCTGGG - Intronic
1060341448 9:122780267-122780289 CCTATGATGTGCCAGGTGCTTGG + Intergenic
1060563254 9:124565984-124566006 CCTATCAGGAGGCAAGTTCAAGG + Intronic
1061154190 9:128847171-128847193 CCTACCAGGTACTGGGTTCTGGG + Intronic
1061382844 9:130268662-130268684 CCTGGCAGATGCCAGGTGCTGGG + Intergenic
1203617516 Un_KI270749v1:81690-81712 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1186959873 X:14724286-14724308 CCTATTATGTGCCAGGTACGTGG - Intronic
1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG + Intronic
1189281685 X:39823583-39823605 CCTATCTGGTGGCTGGTGCTAGG - Intergenic
1190553997 X:51615418-51615440 CCTCTCAGGTGCGATGTTTTTGG - Intergenic
1191665827 X:63701370-63701392 CCTATCAGGCCTCAGGTTCCAGG - Intronic
1191852247 X:65594023-65594045 CTTATCAGGTGGGAGGTTGTAGG + Intronic
1193048848 X:77080290-77080312 CTTATCATGAGCCAGATTCTGGG + Intergenic
1195175213 X:102308177-102308199 CCTACCAGGTGCCTGGTACAGGG + Intronic
1195183652 X:102378916-102378938 CCTACCAGGTGCCTGGTACAGGG - Intronic
1195529245 X:105933024-105933046 CCTATCATATGCCATGTCCTTGG - Intronic
1196703228 X:118694232-118694254 CTTATCCTGTGCTAGGTTCTGGG - Intergenic
1197001773 X:121448490-121448512 CCTATTACGTTCCAGGTACTGGG - Intergenic
1197926038 X:131647580-131647602 CCTTTCAGGTCTCAGGTCCTTGG - Intergenic
1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG + Intronic
1200978918 Y:9243453-9243475 CCTATCATGAGCCAGATTCTGGG + Intergenic