ID: 920053514

View in Genome Browser
Species Human (GRCh38)
Location 1:203177295-203177317
Sequence GACCTGGGTGGTGGTTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 1, 1: 16, 2: 68, 3: 209, 4: 590}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920053514 Original CRISPR GACCTGGGTGGTGGTTACAC AGG Intergenic
900957999 1:5899549-5899571 GGGCTGGGAGGTGGTTACGCAGG + Intronic
901238418 1:7679716-7679738 GCCCTGGCTGGTGGTAACAGAGG - Intronic
902588567 1:17457183-17457205 GATCTGGGCGCTGGTTACATGGG + Intergenic
902942012 1:19807339-19807361 GACTTAGGTGGTAGTTATACAGG - Intergenic
903171566 1:21557822-21557844 GATCTGGGTGGCGGTTACATGGG - Intronic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
903820280 1:26096780-26096802 GAGATGGGTGGTGGTTACATGGG - Intergenic
903890291 1:26565417-26565439 GAGCTGGGTACTGGTTACACAGG - Intronic
904170592 1:28589835-28589857 GACCTGGGTTGTAGTTCCAACGG - Intronic
904405127 1:30283601-30283623 GACCTGGGAGGAGGGTCCACAGG + Intergenic
904416457 1:30364333-30364355 GATTTGGCTGGTGGTTACATGGG + Intergenic
904648161 1:31984003-31984025 GATCTGGTTGATGGTTATACAGG + Intergenic
904801305 1:33094660-33094682 GACCTTGGTGGTGGCTTCCCTGG + Exonic
905419291 1:37828620-37828642 GACCGGGGTGCTGGTTACATGGG + Intronic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
906249288 1:44299083-44299105 GACCTGGGTGGTAGTTACCCAGG + Intronic
906454147 1:45979189-45979211 AACCTAGATGGTGTTTACACAGG + Intronic
907221815 1:52912567-52912589 GATTTGGGTGGTGGTTATAAGGG - Intronic
907224942 1:52936878-52936900 GACCTGGGTGATGGTAGCAAGGG + Intronic
907240992 1:53080976-53080998 GATCTGAGCCGTGGTTACACAGG - Intronic
907466299 1:54639978-54640000 GATCTGGGTGCTGGTTTCATGGG + Intergenic
907958848 1:59259105-59259127 GATATGGGTGGTGGTTACATGGG + Intergenic
908188417 1:61675344-61675366 GAACTGGATGGTGGTTAAATGGG + Intergenic
908218330 1:61977995-61978017 TACCTGGATGGTGGTTACATGGG - Intronic
908648695 1:66308426-66308448 GGTCTGGGTAGTGGTTACATAGG - Intronic
909567517 1:77070586-77070608 GACCTTCGTAGTGGTTACTCAGG - Intergenic
909660987 1:78081916-78081938 GATCTGGGTGATGGTTAAACAGG - Intronic
910204725 1:84737732-84737754 GATCGGGGTGGTGATTACAACGG + Intergenic
910324761 1:85993634-85993656 GATCTTGGTGATGGTTTCACAGG + Intronic
911135461 1:94434770-94434792 GATCTGGGTAGTGGTTAAAAGGG - Intronic
911165744 1:94723079-94723101 GACCTACGTGGTGTTTACATAGG + Intergenic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911806741 1:102219636-102219658 GACCTGGGTAGTGGTTAAAAGGG + Intergenic
913266009 1:117045262-117045284 GACCTAGGTTGTGGTTTCATGGG + Intergenic
913479488 1:119273810-119273832 GATCTGGGTGGTGCTTGCATGGG + Intergenic
916172865 1:162014142-162014164 GAGCTGGTTGGTGGTTACACAGG + Intronic
916246465 1:162693234-162693256 GCCCTGAGTGGTGATAACACAGG + Intronic
916592586 1:166206633-166206655 GACCTGAGTGGGGGCTACCCTGG - Intergenic
916640985 1:166728890-166728912 GATCTGGGTTTTGGTAACACAGG + Intergenic
917844687 1:179010875-179010897 GGCCTGGGTGGCTGTTACATGGG + Intergenic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
918510250 1:185304784-185304806 GACTTGGGTAGTGTTTACACTGG + Intronic
918744634 1:188183943-188183965 GACCTGGGGGCTGGTCACAGTGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
919768451 1:201142109-201142131 GGCCTGGGAGGTGGTGGCACTGG - Intronic
919963679 1:202499084-202499106 GATTTGGGTAGTGGTTATACTGG - Intronic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920385256 1:205567065-205567087 GATCTAGGTGGTAGTTACACAGG - Intergenic
920892414 1:210002200-210002222 TACCTGGGTTCTGGTTACATAGG - Intronic
920904797 1:210152633-210152655 GACCTGGATGGTAATTACATGGG - Intronic
921274700 1:213507397-213507419 GACCTGGGTAGAGGTAAAACTGG + Intergenic
921533554 1:216315517-216315539 GACAGGGATGGTGATTACACAGG + Intronic
921540737 1:216411608-216411630 GCAGTGGGTGGTGGCTACACTGG + Intronic
921965480 1:221083718-221083740 GATCTGGGTGCTGGATGCACGGG + Intergenic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922439289 1:225639247-225639269 GACCTGGTTGGTGGCTACACAGG + Intronic
922889994 1:229054580-229054602 AACCTGTGTTTTGGTTACACAGG - Intergenic
923054914 1:230418814-230418836 GATCTGGGTGGTAGTGACACAGG + Intronic
923165152 1:231354469-231354491 GATCCGGGTGGTAGTTACACAGG - Exonic
923357167 1:233169727-233169749 GAACTAGTTGGTGGTTACAGAGG - Intronic
923384670 1:233454393-233454415 CACCTGAGTGGTGGAAACACGGG + Intergenic
923646487 1:235826646-235826668 GATCTGGGTGGTGATGACACAGG + Intronic
924295385 1:242581840-242581862 GATCTTGGCTGTGGTTACACAGG - Intergenic
924520377 1:244801113-244801135 GACCTGGATGGTAGTTACAAGGG + Intergenic
924572123 1:245246488-245246510 GGCCTGGGTGGTGGGGAGACTGG - Intronic
924876698 1:248112737-248112759 GAACTGGCAAGTGGTTACACAGG - Intergenic
1063635371 10:7777399-7777421 TATCTGGGTGGTGGTTCCACAGG + Intronic
1063761195 10:9078892-9078914 GACCTGGCTTATGGTTACAAGGG + Intergenic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1064713881 10:18155131-18155153 TACCTGGGTGGTGGCTCCACAGG - Intronic
1065045842 10:21747134-21747156 GACAAGGGTGGTGGCCACACTGG - Intergenic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1065940470 10:30559779-30559801 GAGCTGGGTGATGGATACATAGG - Intergenic
1066251963 10:33642174-33642196 GAACTGGGTGCTAGTTACAAGGG + Intergenic
1067949744 10:50721889-50721911 GATCTAGGTGCTGGTTACATAGG - Intergenic
1068546299 10:58349735-58349757 GAGCTGGGTGCTGGTTTCACAGG - Intronic
1068961439 10:62870477-62870499 GAGCTGGGTGCTGGTCACACAGG + Intronic
1069015200 10:63421496-63421518 GACCTGGGGGATAGTTACACAGG + Intronic
1069306254 10:66974015-66974037 GATTTGTGTGGTGGTTACACTGG - Intronic
1069435927 10:68382804-68382826 GACCTGGGTGGAGGTTACGCAGG + Intronic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1069649640 10:70036100-70036122 ACCCTGGGTGGGGGTTACAAGGG + Intergenic
1069760150 10:70804530-70804552 GATCTATGTGGTGGTTACATGGG + Intergenic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1071532267 10:86399743-86399765 GGCTTGGGTAGTGGTTACAAAGG + Intergenic
1071852809 10:89592378-89592400 GATCTGGGTGATGGCTATACAGG + Intronic
1072240858 10:93494735-93494757 GGCCTGGGTGCTGGCTACCCAGG + Intergenic
1072270877 10:93775155-93775177 GACCTGGGTGCTGGTTACAAGGG - Intronic
1072282249 10:93877321-93877343 GATCTGGGTGCTGTTTACATGGG + Intergenic
1072865549 10:99057112-99057134 GACTGAGGTGGTGGTTACATAGG + Intronic
1073167482 10:101469686-101469708 AATTAGGGTGGTGGTTACACAGG - Intronic
1073834171 10:107421691-107421713 TATCTGGGTGGTAGTTAAACAGG + Intergenic
1073874875 10:107911011-107911033 AACCTTGGTGGTAATTACACTGG - Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1074671049 10:115791410-115791432 AACCTGGGTGGTGATTAGACAGG - Intronic
1074718918 10:116248023-116248045 ATTCTGGGTGGTGGGTACACAGG + Intronic
1074917334 10:117970162-117970184 GAGCTGGGTGGTGAGTTCACAGG + Intergenic
1075194041 10:120339271-120339293 GTCTTGGGTGGTGATTCCACAGG + Intergenic
1075263353 10:120981013-120981035 CATCTGGGTGCTGGTTTCACAGG - Intergenic
1075422403 10:122311728-122311750 GGTCTGGGTGCTGGTTACACAGG - Intronic
1075425357 10:122337752-122337774 GTTCAGGGTGATGGTTACACAGG + Intronic
1075425677 10:122340038-122340060 GATCTGGGTGCTGGTTATATGGG - Intergenic
1075547975 10:123369838-123369860 GATCTGGGTGCTGGTTGCATGGG + Intergenic
1075718310 10:124569884-124569906 GATCTGTGTGGGGGTTACACGGG - Intronic
1075820698 10:125306440-125306462 GACCTGGGAGGTGGTTACAAGGG - Intergenic
1076208263 10:128620523-128620545 GATCTGGGCCATGGTTACACAGG - Intergenic
1076227411 10:128790928-128790950 GACCGGGGTGGTAATTACAAGGG + Intergenic
1076314987 10:129533657-129533679 GGCCTGGATGGTGGTCACACTGG + Intronic
1076349051 10:129802072-129802094 GACTGGGGTGTTGGTTACACAGG - Intergenic
1077350986 11:2093111-2093133 GACCTGGTTGGGAGTTCCACTGG - Intergenic
1077649291 11:3955288-3955310 GATTGGGGTGGTGGTTACACAGG + Intronic
1077661829 11:4075317-4075339 GATCTGGGTGGTAGTAACACAGG - Intronic
1078098009 11:8312337-8312359 GATCTGGGTGGTGATTCCATGGG - Intergenic
1078151535 11:8763764-8763786 GATCTGAGTGTTGGTTACATGGG + Intronic
1078195954 11:9137329-9137351 GACCTGAGTGGTGATTATAAGGG + Intronic
1078265699 11:9755019-9755041 TCAATGGGTGGTGGTTACACAGG + Intergenic
1078374116 11:10778548-10778570 GACCTAAATAGTGGTTACACAGG - Intronic
1079204770 11:18404901-18404923 GAGCTGGGTGGTGGGTTCACAGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1079456931 11:20644750-20644772 GATTTGGGTGCTGGTTACATTGG - Intronic
1079996568 11:27300921-27300943 AACCTGAGTGATGGTTATACGGG - Intergenic
1080730410 11:34945804-34945826 GATCTAGGTGGTGGTAACATGGG - Intronic
1080877233 11:36287875-36287897 GACTTTGGTGGTGGTTACATTGG + Intronic
1081641751 11:44760443-44760465 GATCTGGGTTTTGGTTGCACAGG + Intronic
1081719846 11:45280578-45280600 GACGTGGGTGCTGGTTACAGAGG - Intronic
1081811310 11:45915658-45915680 GTCCTGGGTGGGGGTGACGCAGG - Intronic
1082902735 11:58273348-58273370 GATCTGAGTGGTGATTACAAAGG - Intergenic
1083294039 11:61705791-61705813 GCCCTGGGTGGTGTGAACACAGG - Intronic
1083701332 11:64479992-64480014 GATGAAGGTGGTGGTTACACAGG - Intergenic
1083845682 11:65331646-65331668 CATCTGGGTAGTGGTTACACAGG + Intergenic
1084287036 11:68138699-68138721 GAGCTAGGTGGTGGGTACACAGG + Intergenic
1084496557 11:69508084-69508106 GATCTTGGTGGTGGTTTCATGGG - Intergenic
1084922913 11:72486069-72486091 GATCTGGGTGATAGTTCCACAGG + Intergenic
1085174525 11:74474424-74474446 CACCTGGATGGTGCTGACACAGG + Intergenic
1085331631 11:75656864-75656886 GATCTGAGTGGTGGTGACATGGG - Intronic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1085553703 11:77399978-77400000 AATCTAGGTGGTGGGTACACAGG + Intronic
1085655267 11:78308830-78308852 GACCTGGGTGGTAATTACATGGG + Intronic
1085907025 11:80775775-80775797 GAGCTGGATGGTGGTTACCAAGG + Intergenic
1087086451 11:94223651-94223673 AATCTGGGGGGTGGTTACATAGG - Intergenic
1087237090 11:95732169-95732191 GAAATGGATGGTGGTTACATGGG - Intergenic
1087696719 11:101387021-101387043 GATCTAGGTAATGGTTACACAGG - Intergenic
1088308110 11:108431545-108431567 GATCTGGGTGACGGTTACATAGG + Intronic
1088348822 11:108861702-108861724 AAACTGGGTGGTAGTTACATGGG + Intronic
1089034722 11:115375411-115375433 GACCTCGGTAATGGTTACTCGGG + Intronic
1089102954 11:115979501-115979523 GATCTGGGTGGTAGTTATACAGG - Intergenic
1089516104 11:119032762-119032784 AATTTAGGTGGTGGTTACACGGG - Intergenic
1089769622 11:120793823-120793845 GAGCTGGGTGGTGGTTAGAGGGG + Intronic
1089776144 11:120837584-120837606 GAGCTGTGTGCTGCTTACACAGG - Intronic
1089880893 11:121772384-121772406 GAACTGTGTGGTGATTACACGGG + Intergenic
1090772901 11:129937170-129937192 GATCTGGGTGCAGGTTACATGGG + Intronic
1091338417 11:134791851-134791873 GTACCGGGTGGTGGTCACACAGG + Intergenic
1091909001 12:4213738-4213760 GACTTGGGTGATGGTTACATGGG - Intergenic
1092043870 12:5410857-5410879 GATCTGGGTGATAGTTACATAGG - Intergenic
1093869485 12:24270586-24270608 GACCTGTGTGGTGCTTCCATGGG - Intergenic
1094262372 12:28515820-28515842 GGCCTGGGTCCTTGTTACACAGG - Intronic
1094345751 12:29466660-29466682 GATCTGGGTGTTGGTTACATGGG + Intronic
1094595373 12:31860982-31861004 AAACTAGGTGGTGGGTACACTGG - Intergenic
1094838809 12:34334509-34334531 GACTTGGGAGGTGGACACACCGG + Intergenic
1095215433 12:39542058-39542080 AACCTGGGTGGTGGTTAAACAGG + Intergenic
1095529616 12:43171243-43171265 GATGTGGGTGCTGGTAACACAGG - Intergenic
1095877042 12:47090537-47090559 GATTTGGGTGATGGTTACAAGGG - Intronic
1096167761 12:49438040-49438062 GATCTGGGTGGTAATTACATGGG - Intronic
1096442747 12:51659369-51659391 GATTTCAGTGGTGGTTACACAGG + Intronic
1096602497 12:52739697-52739719 GAGGTGGGTGATGGGTACACAGG + Intergenic
1096642347 12:53004633-53004655 GATGTGAGTGGTGGTTACATGGG - Intergenic
1096725649 12:53559752-53559774 GAACTGGGTAGTGATTACACAGG - Intronic
1097238847 12:57559613-57559635 GATCTGTGTAGTGGTTACATGGG - Intronic
1097281160 12:57846187-57846209 GACCTCCGTGGGGGTTGCACGGG - Intronic
1097294571 12:57948679-57948701 AGTCTGGGTGGTGGTTACATAGG - Intronic
1097459226 12:59839636-59839658 GCCCAGAGTGGTGGTTACAAGGG - Intergenic
1097475802 12:60054278-60054300 GAGGTGGGTGATGGGTACACAGG + Intergenic
1097980840 12:65736757-65736779 GACCAGTGTGGTGATTACAAAGG + Intergenic
1098599700 12:72316465-72316487 GATCTGGGTGGTGGTTATCCGGG - Intronic
1099838658 12:87938634-87938656 GATCTGGTTGGTGTTTACAGGGG - Intergenic
1100351424 12:93787229-93787251 CTCATGGGTGGTGGTTAAACTGG + Intronic
1100505920 12:95220137-95220159 GATCTGGGTGCTGGTTACATGGG - Intronic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100593030 12:96046902-96046924 GATCTGGGTGCTGATTGCACTGG - Intergenic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1100835438 12:98562714-98562736 GATCAGGGTGGTGGTTAAATAGG + Intergenic
1101600340 12:106204227-106204249 GAAATGGGTGCTGGTTACATGGG - Intergenic
1101610590 12:106287786-106287808 GGGCTGGGGGGTGGTTACAGAGG + Intronic
1101633062 12:106514225-106514247 GACCTGAGTGCTGATTACATGGG + Intronic
1101701764 12:107180425-107180447 GACCTAGGTGGTGGCTACATGGG - Intergenic
1101806285 12:108067117-108067139 CCCCAGGGTGGTGGTTACTCAGG - Intergenic
1101813512 12:108128628-108128650 GATCTGGCTGGTGGCTGCACAGG - Intergenic
1101834339 12:108284818-108284840 GACCTAGATAGTGGTTACACGGG - Intergenic
1101917803 12:108909636-108909658 GACCTTGGTGGTGTTCACAATGG - Intergenic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1101981655 12:109412627-109412649 GATCCGCATGGTGGTTACACAGG - Intronic
1101981816 12:109414066-109414088 AATCTGGGTGCTGGTTGCACAGG + Intronic
1102223241 12:111209132-111209154 GAACTGGGTAGTGCTTACTCAGG + Intronic
1102316483 12:111891908-111891930 GATCTAGGTGCTGGTTACAGAGG - Intronic
1102392519 12:112560792-112560814 GACCTGAATGCTGGTTACATTGG - Intergenic
1102431488 12:112887533-112887555 GACCTGGGTGGGAATTACATGGG + Intronic
1102808877 12:115806712-115806734 GACCTAAATTGTGGTTACACAGG - Intergenic
1102897001 12:116606189-116606211 AACTTGGGTGATGGTTATACGGG - Intergenic
1103313899 12:120035736-120035758 AACCTGTGTGGTGGTTACAAAGG - Intronic
1103317683 12:120069770-120069792 GATCTCCATGGTGGTTACACAGG - Intronic
1103335346 12:120185182-120185204 GATCTGGGTGCTGGTTATACTGG + Intronic
1103720506 12:122972464-122972486 GATCTGGGTGCTGGTTACATGGG + Intronic
1103762074 12:123257839-123257861 CACCTGGGTGGTAGTTAGAAGGG + Exonic
1103872847 12:124103169-124103191 GACCAGGGTAGAGGTTACACAGG - Intronic
1103896508 12:124277144-124277166 TACCTGGGTGGTGGTCACGTAGG + Intronic
1103994949 12:124823164-124823186 GATCTGGTTGCTGGTTACCCGGG + Intronic
1104357600 12:128101546-128101568 TGCCTTGGTGGTGGCTACACTGG - Intergenic
1104645519 12:130494723-130494745 GCCCTGTGTGCTGGTTACTCAGG + Intronic
1105553350 13:21419780-21419802 GAATTGGGTGGTAGTTACACAGG + Intronic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1106176996 13:27340204-27340226 ATCCTGGGTGGTGGTGACTCTGG + Intergenic
1106452631 13:29896605-29896627 GATTTGGGTGTTGGTTACATGGG - Intergenic
1106664337 13:31835983-31836005 GATTTGGGTGGTGCTTGCACAGG + Intergenic
1107522753 13:41199715-41199737 GACCGGGCTGGTGGTTACATGGG + Intergenic
1107523084 13:41202492-41202514 GACCTGAGTGGAGGTTACACAGG - Intergenic
1108202054 13:48053887-48053909 GATCTAGGTGGTGGTTATATAGG - Intronic
1108244875 13:48504166-48504188 GACCTGGGAGGCTGTTACAGGGG - Intronic
1108367436 13:49730063-49730085 GCTTTGGGTGGTGGTTACAGAGG + Intronic
1108719215 13:53113273-53113295 TACCTGGGTGGGGCTTACATGGG - Intergenic
1109933694 13:69250737-69250759 AATCTGGGTGGTTGTTACCCAGG - Intergenic
1110715231 13:78695118-78695140 TACCGGGATAGTGGTTACACAGG - Intergenic
1111051397 13:82886595-82886617 GAACTGGGTGCAGGTTACACTGG + Intergenic
1111633488 13:90873775-90873797 GGACTTGGTGGTGGTTCCACAGG - Intergenic
1111681069 13:91442163-91442185 AACCTGGGTGGTAGTTACAAGGG - Intronic
1111862855 13:93730046-93730068 GCCCTGGGTGCTGGTCACACAGG + Intronic
1112125734 13:96465693-96465715 AACCTGGGTGGTGCTTACATAGG + Intronic
1112279456 13:98049910-98049932 AATCTGGGTGGCAGTTACACAGG - Intergenic
1112677977 13:101726470-101726492 GATCTAGGTGATGGTTGCACAGG - Intronic
1112736423 13:102425278-102425300 TATCTGGGTGCTGGTTACACAGG + Intergenic
1113182385 13:107644809-107644831 GATCTGGGTGGTGGTTCCAGAGG - Intronic
1113585265 13:111460277-111460299 GACCTGGTTGCTGGCCACACTGG + Intergenic
1113841006 13:113361564-113361586 GACCTGGAGGTTGGTTACAGCGG - Intronic
1114366308 14:22030558-22030580 GATATGGGTGCTGGTTACATGGG - Intergenic
1114420552 14:22578731-22578753 GATCTGGATAGTGGTTAGACAGG + Intronic
1115097780 14:29659089-29659111 GATCTGGGTAGAGGTTACATGGG - Intronic
1115927804 14:38456556-38456578 GATCTGGGTGCTGATTACAGTGG - Intergenic
1117119894 14:52555377-52555399 AATCTGGGTGGTGGTAACATGGG - Intronic
1117230328 14:53710499-53710521 GGCCTGGGTGATGGTTACTTGGG + Intergenic
1117288639 14:54311221-54311243 GATCTGGGTGTTGGTTGCATGGG - Intergenic
1117294719 14:54368779-54368801 GATCTGGGTGCTGGTTACGCGGG + Intergenic
1117301381 14:54431810-54431832 GATCTGGGTGGTAGTTTAACAGG + Intronic
1117385992 14:55213397-55213419 TATCTGGGTGGTGATTACATAGG + Intergenic
1117386169 14:55215084-55215106 AACTTGAGTGGTGGTTACACGGG + Intergenic
1117912473 14:60648686-60648708 GACCTGGGTGGTGGTGAGGCCGG + Exonic
1118478222 14:66138928-66138950 GATCTTGGTGGTGGTCACACAGG - Intergenic
1118929223 14:70224611-70224633 GACCTGGGTGGTGGTTACGCAGG + Intergenic
1119335799 14:73832579-73832601 GACTTGAGTGTTGGTTACACAGG + Intergenic
1119568898 14:75652620-75652642 GAGCTGGGTGTTGGTTGCATTGG - Intronic
1121062496 14:90926529-90926551 CACTTGAGTGGTGGTTACAAGGG + Intronic
1121088652 14:91166173-91166195 GATCTGGATGCTGGTTACATGGG + Intronic
1121238298 14:92409563-92409585 GACCTGGATGCTGGTGACATGGG - Intronic
1121259393 14:92555093-92555115 GATTTGGGTGGTAGTTACACAGG + Intronic
1121266729 14:92608269-92608291 GAACTGGGTGAAGGGTACACAGG + Intronic
1121673912 14:95736679-95736701 GAGCTGGGTGCTGGTCACACAGG + Intergenic
1122240642 14:100364071-100364093 GATTTGGGTGCTGGTTACACAGG + Intronic
1122594900 14:102883534-102883556 GACCTGGGTGTTGGCTTCATGGG + Intronic
1123692474 15:22850037-22850059 AAGCTGGGTGATGGGTACACAGG - Intronic
1124961607 15:34401165-34401187 GACCAGGTTGGTGGTTACATGGG - Intronic
1124978233 15:34547387-34547409 GACCAGGTTGGTGGTTACATGGG - Intronic
1124987525 15:34636215-34636237 GACCTGGGTGGGGGTCATCCAGG + Intergenic
1125262650 15:37845227-37845249 GAACTGGGTAGTGGTCACATGGG + Intergenic
1125532903 15:40425234-40425256 GACCTGCGTGTTGGGTACACAGG - Intronic
1125710573 15:41782350-41782372 CACTTGGGCAGTGGTTACACGGG - Intronic
1125762704 15:42108017-42108039 GATCAAGGTGGTGGTTACAGGGG + Intergenic
1125905587 15:43389080-43389102 GATCTGGGTGCTGGTAATACAGG + Intronic
1125935189 15:43628890-43628912 GATCTGCATGGTGGTTACACCGG - Intronic
1125947947 15:43725202-43725224 GATCTGCATGGTGGTTACACCGG - Intergenic
1126801185 15:52298187-52298209 GATCTGGGCGGTGGTTACTTTGG - Intergenic
1127553333 15:60062799-60062821 TACCTGGGTGGTTCTTACTCAGG + Intergenic
1127798880 15:62460812-62460834 GAGCTGGATGCAGGTTACACAGG - Intronic
1127865702 15:63030789-63030811 GTTCTGGGTGCTGGTTACAAGGG + Intergenic
1128158425 15:65407071-65407093 GACCTGCGTGGAGGATACACAGG - Intronic
1128458803 15:67850536-67850558 CACTTGGGTGCTGGTTACTCAGG + Intergenic
1128592083 15:68908217-68908239 GACCTGGGTAGAAGTTACACGGG - Intronic
1128863919 15:71098340-71098362 TAGCTGGGTGGTGGTGGCACGGG - Intronic
1129155853 15:73717311-73717333 GATCTGGGTAGTGGTTACATGGG - Intergenic
1129222823 15:74142904-74142926 GATCTGGATGGTGGCTACATGGG + Intergenic
1129755617 15:78097270-78097292 GACCTGAGTGGCAGTTACATGGG + Intronic
1129828959 15:78654798-78654820 GAGCTGGATGCTGGTTACACAGG - Intronic
1129996629 15:80012199-80012221 GTGCTGGCTGGCGGTTACACAGG + Intergenic
1130014792 15:80178270-80178292 GATCTGGGTGCTGGTTGCACAGG - Intronic
1130194385 15:81765420-81765442 GACCTAGGTGGTTATTACAATGG - Intergenic
1130194945 15:81770936-81770958 GATCTGGGTACTGATTACACAGG + Intergenic
1130266454 15:82409067-82409089 GACCAGGTTGGTGGTTACATGGG + Intergenic
1130292428 15:82614322-82614344 GACCTGGGTAGTGGTTATGTGGG + Intronic
1130505570 15:84537815-84537837 GACCAGGTTGGTGGTTACATGGG - Intergenic
1130567292 15:85007442-85007464 GATCTGGGTGCTGGTTATACAGG + Intronic
1130819074 15:87473579-87473601 TATTTGGGTGATGGTTACACTGG + Intergenic
1130884594 15:88082443-88082465 CATCTGGGTGGTGGTGATACAGG - Intronic
1130966834 15:88704095-88704117 AACCTGGGTGGAGATTACACAGG - Intergenic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1131138407 15:89956968-89956990 GACTTGAGTAGTGGTTACATGGG + Intergenic
1131776624 15:95808426-95808448 GATCTGGGTGATGGTTACAAGGG + Intergenic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1133691283 16:8217923-8217945 GCTCTCGGTGGTGGTTACATGGG + Intergenic
1134117126 16:11557353-11557375 CACCTGGGGGCTGGTTACAGAGG + Intronic
1134147384 16:11777107-11777129 GACCTGGATGGTGTGTACATGGG - Intronic
1135102675 16:19620447-19620469 AAGCTGGGTGGTGGGTACCCAGG + Intronic
1135184300 16:20301616-20301638 GAACGGGGTGATGGTTACACAGG + Intergenic
1135484601 16:22853122-22853144 GATCTGGGTACTGGTTACACAGG - Intronic
1135632131 16:24044415-24044437 GACATGGGAACTGGTTACACAGG + Intronic
1135948843 16:26893050-26893072 AAACTGGGTGTTGGGTACACAGG - Intergenic
1137575860 16:49599926-49599948 GATGTGGGTGCTGGTTACACAGG + Intronic
1137601427 16:49758974-49758996 GACCTGGGAAGTGGTTTCAATGG + Intronic
1137735373 16:50719638-50719660 GTCCTGGGAGGTGGTTTCCCCGG - Intronic
1137866929 16:51907410-51907432 GATCTGGGTAGTGGACACACAGG - Intergenic
1138038866 16:53639916-53639938 GATGTGGGTGGTAGTTACACAGG + Intronic
1138165756 16:54800179-54800201 GACCTGGCTTGTGGTTTCAAGGG + Intergenic
1138385631 16:56634019-56634041 GGACTGGGTGGGGGTTAAACTGG + Intergenic
1138489204 16:57366346-57366368 GGCCTGGGAGGTGGCTGCACAGG + Intergenic
1138515358 16:57533060-57533082 GACCTGGGTGGTGCCTGCCCTGG - Intronic
1138524426 16:57593857-57593879 TACCAGGGTTGTAGTTACACAGG - Intergenic
1139191034 16:64863514-64863536 GAACTGGGTGATGGCTATACAGG - Intergenic
1139363786 16:66420348-66420370 GAGCTGGGTGCTGGGTACACAGG - Intergenic
1139389608 16:66598512-66598534 GATTGGGGTGGTGGTTACACAGG - Intergenic
1139594608 16:67950450-67950472 GAACTTGGTGGTGGGCACACTGG - Exonic
1139676206 16:68525573-68525595 AAACTGGGTGATGGGTACACGGG + Intergenic
1139795372 16:69478933-69478955 GTCCTGGGTGATGGATACATTGG - Intergenic
1140155061 16:72416320-72416342 CACCTAGGTGGTAGTAACACAGG - Intergenic
1140707700 16:77646173-77646195 GATCTGGGTGTTGGTTACATAGG + Intergenic
1140897119 16:79334490-79334512 GACCAAGGAGGTGGTTACATGGG + Intergenic
1141161490 16:81632123-81632145 GATCCAGGTGGTGGTTACTCAGG - Intronic
1141500099 16:84438231-84438253 AAGCTGGGTAGTGGCTACACAGG - Intronic
1141520171 16:84573443-84573465 GATCTGGGTGGTGGCTTCAAAGG + Intronic
1141558571 16:84852294-84852316 CATCTGGATGGTAGTTACACGGG - Intronic
1141944187 16:87298321-87298343 GACCTCGGTGGTGGTGGCAGTGG - Intronic
1142114644 16:88350315-88350337 GACCTGGATGGTGCCCACACAGG + Intergenic
1142116433 16:88358460-88358482 GATCTGGGTGGTTGGTACATGGG - Intergenic
1143137571 17:4720316-4720338 AGCCTGGGTGGGGGTCACACTGG + Intronic
1143370843 17:6438127-6438149 GACCTAGGTGATGGTTACATGGG + Intergenic
1143566983 17:7728236-7728258 AATCTGGGTGGTGGTCATACAGG + Intronic
1143572862 17:7771449-7771471 GACCTGGGTGATGGGTGCTCCGG - Exonic
1143844220 17:9760583-9760605 GATCTGCATGGTGGTTACATGGG + Intergenic
1144083790 17:11788427-11788449 GATCTGAGTGGTGATTACATAGG - Intronic
1144533845 17:16067730-16067752 GATCTGGGTGCTGGTAACATGGG + Intronic
1144887668 17:18474718-18474740 GTTCTGGGTGGTGGTCCCACAGG - Intergenic
1145144548 17:20469582-20469604 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145176000 17:20700984-20701006 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145243775 17:21254340-21254362 GATTTGGATGGTGGTCACACGGG - Intergenic
1145302863 17:21653284-21653306 ACCCTGGGTGGTGGTGACAGTGG - Intergenic
1145347442 17:22049907-22049929 ACCCTGGGTGGTGGTGACAGTGG + Intergenic
1145416138 17:22715425-22715447 GCTCTGGGTGGTGGTGACAGTGG - Intergenic
1145806884 17:27740731-27740753 GTTCTGGGTGGTGGTCACACAGG - Intergenic
1145832029 17:27924170-27924192 GATTTGGGTGGTGGTTCCAGGGG + Intergenic
1145958984 17:28874926-28874948 GACCTGGATGGTGATTACATGGG - Intergenic
1146234674 17:31147161-31147183 GATCTGGATACTGGTTACACTGG - Intronic
1146625856 17:34434986-34435008 TTCCTAGGTGGTGGTGACACAGG - Intergenic
1146673488 17:34757709-34757731 GACCTGGGAGGTGGTTTCCTGGG - Intergenic
1147127784 17:38384186-38384208 GGGCTGGGTGATGGATACACAGG - Intronic
1147560585 17:41506560-41506582 GTCCTGGGTGGTGTTTACACAGG - Intergenic
1148107772 17:45128429-45128451 GGCCTGGGTGGTGGGTAAGCTGG - Intronic
1148466802 17:47869780-47869802 GAGCTGAGTGTTGGTTACCCAGG + Intergenic
1148641084 17:49188156-49188178 GATCTAGGTGATGGTGACACAGG + Intergenic
1148765076 17:50033912-50033934 AACCTGGGTTCTGGTTACACAGG + Intergenic
1149026574 17:52034546-52034568 GAGCTGGGGGATGGTTACATAGG + Intronic
1149211097 17:54302156-54302178 GACCTGAGTAGTGGTTTCATGGG + Intergenic
1149234738 17:54577090-54577112 GACCTGGGTAAGGGTTACATAGG - Intergenic
1149448231 17:56730261-56730283 AATCTGGGTGCTGGTTACAAAGG + Intergenic
1149460786 17:56828617-56828639 AACCTGGGTAGTGGGTACACAGG - Intronic
1150299107 17:64033761-64033783 GATCTGGGAGGTGGTTATACTGG + Intergenic
1150360051 17:64524187-64524209 GACCTGGGTGGCAGTTAAAGGGG + Intronic
1150646847 17:66983998-66984020 GATCAGGGTGCTGGTTATACGGG + Intronic
1151581796 17:74983474-74983496 GAGCTGGGTGCTGGTTACACAGG - Intergenic
1152100599 17:78299618-78299640 GACCTGGGTGAGGGTGACATAGG - Intergenic
1152636191 17:81431420-81431442 GACCTGGGTGCTGGTCACCATGG - Intronic
1152788981 17:82268080-82268102 GACCTTGGTGTCGGTTCCACAGG - Intronic
1153270993 18:3321079-3321101 GATCTGGGTGGTGGCTATAGGGG + Intergenic
1154321429 18:13356632-13356654 GACTTGAGTGGTGGTTCCAGGGG - Intronic
1154503323 18:15007279-15007301 ACCCTGGGTGGTGGTGACAGTGG - Intergenic
1155879203 18:31123029-31123051 GACCTGGGGCAGGGTTACACTGG + Intergenic
1156210929 18:34941678-34941700 GAGCATGGTGATGGTTACACTGG + Intergenic
1156283362 18:35664177-35664199 GATTTGGCTGATGGTTACACAGG - Intronic
1157885936 18:51366383-51366405 GATCTCAGTGGTGGTTACACAGG - Intergenic
1158605965 18:58896473-58896495 GACATGGGTGGTGGCTTGACTGG - Intronic
1158982351 18:62775766-62775788 GACTGTGGTGGTGGTTTCACAGG - Intronic
1159047921 18:63387114-63387136 GATCTGGGTGGTTGATACAAAGG - Intergenic
1159678701 18:71319831-71319853 GACCTGAGTGCTGGTCACATGGG + Intergenic
1159908011 18:74115995-74116017 GACCTGGATGGTGATCACACAGG + Intronic
1160561215 18:79757087-79757109 CACCACGGTGGTGGATACACGGG - Intergenic
1162856109 19:13469768-13469790 GAGCTGGGAGGTGGTTAAAGAGG - Intronic
1162860511 19:13503330-13503352 GACCTGGGTGCTGGATACGTGGG + Intronic
1163815795 19:19463694-19463716 CACCTGGGTGGTGGTGAGACAGG + Intronic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1164852230 19:31493581-31493603 GACCTAGGTGGTAGGTATACAGG - Intergenic
1165296893 19:34934719-34934741 GACCAGAGTGATGGTTACAAAGG - Intronic
1165334366 19:35158670-35158692 GACCCGGTTGGTAGTTACATAGG - Intronic
1165534770 19:36434523-36434545 GACCTGAGTTCTGGTTACACAGG + Intergenic
1165840357 19:38785540-38785562 GATTGGGGAGGTGGTTACACAGG + Intergenic
1165923444 19:39312939-39312961 GAGCTGGGTGCTGGGGACACAGG - Intronic
1165986713 19:39775991-39776013 GATCTGGGTGCTGGCTACATGGG + Intergenic
1166203836 19:41256059-41256081 AATCTGGGTGCTGGTTACATGGG + Intronic
1166570626 19:43794266-43794288 GACCTAGGTGGAGGTTATTCAGG + Intergenic
1166811759 19:45518636-45518658 GATCTGGGAGGTGGTTTCCCGGG - Intronic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1167024676 19:46906575-46906597 GACTTGGGTAGTGGTTATATTGG - Intergenic
1167084725 19:47301382-47301404 GATCTGAGTGTTGGTTACACAGG - Intronic
1167141803 19:47656705-47656727 GAGCTGAGTGATGCTTACACAGG - Intronic
1167450488 19:49565368-49565390 GATCTGGGTGCTGGTTACATGGG + Intronic
1167456937 19:49601374-49601396 GAGCTGAGTGGTAGTTACAGAGG + Intronic
1167731640 19:51261935-51261957 GACCTCAGTGGTGGTTACACTGG - Intronic
1168299538 19:55396366-55396388 GACCTGGGTATTGGTTACATAGG - Intronic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
1168722115 19:58559851-58559873 GACTTGGGTGCAGGTAACACAGG - Intergenic
924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG + Intergenic
925597882 2:5574200-5574222 GATTGGGGTGATGGTTACACAGG - Intergenic
925767151 2:7247185-7247207 AACCTGTGTGGTGGTGACAGTGG + Intergenic
925819012 2:7780745-7780767 GATCTGGGTGCTGGTTACATGGG - Intergenic
925971496 2:9109737-9109759 AGGCTGGGTGGTGGTTTCACAGG + Intergenic
926187855 2:10705637-10705659 GACCTGGGTGGTGGCTTCATGGG + Intergenic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
926628404 2:15114741-15114763 GACCAGGGAGGTGGGTACAAGGG + Intergenic
926751838 2:16204313-16204335 GAGCTGGGTGCTGGTTGCAGGGG + Intergenic
927659966 2:24984784-24984806 GATCTGAGTGGGGGTTACATAGG + Intergenic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928145710 2:28773107-28773129 GATCTGGATGATGGTTACTCAGG + Intronic
928182306 2:29077464-29077486 GACCTAGGTGGTAGTTATATGGG + Intergenic
928319209 2:30269789-30269811 GACCTGGGTAGTGGTTTTATGGG - Intronic
928342031 2:30452135-30452157 GAGATGTGTGGTGGTTACATGGG + Intronic
928346774 2:30505610-30505632 TAACTGGCTGCTGGTTACACAGG - Intronic
928649684 2:33391184-33391206 GGCCTGGGTGGGAGTTACACAGG - Intronic
928991315 2:37235360-37235382 GATTTGGGTGCTGGTTACATGGG - Intronic
928997075 2:37303899-37303921 GACCTGAGTGGTGGTTATGTGGG - Intronic
929171705 2:38938656-38938678 GATCTGGGTGGTGATCACAGGGG - Intronic
929752356 2:44728913-44728935 AATCTGGGTGGTGGTTAGAAGGG + Intronic
930173291 2:48274216-48274238 GGCTTGGTTGGTGGTTACAAAGG - Intergenic
930414177 2:51068877-51068899 TATCTGGTTGGTGGTTACACAGG - Intergenic
930854209 2:55994984-55995006 GACCTGGGTGGTAGTTACGTGGG - Intergenic
931468542 2:62514238-62514260 GATCTGGTTGCTGGTTACACAGG - Intergenic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
932087364 2:68774321-68774343 GTCCTGGGTGGGGGTTACCATGG + Intronic
932313198 2:70760699-70760721 GACCTGCATGGTGGTCACACGGG + Intronic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
933018197 2:77158164-77158186 GAACTGTGTGGTGGTTGCAAGGG + Intronic
933568879 2:83983810-83983832 GACCTGAGTGGTGATTACACAGG - Intergenic
933990223 2:87628510-87628532 GACCTGGGTGGAGGTGAGACTGG + Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
935100067 2:99985799-99985821 CACCTGAGTGATGGTTATACAGG + Intronic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
936303623 2:111322314-111322336 GACCTGGGTGGAGGTGAGACTGG - Intergenic
936339864 2:111621600-111621622 GATCTTGGTGGTGGTTTCATGGG + Intergenic
936348936 2:111697900-111697922 AACCTGGGTGGAGGGTACCCAGG + Intergenic
936645286 2:114362128-114362150 GGTCTGGGCGGTGGTTACACAGG + Intergenic
937892091 2:126946696-126946718 AACCTGGGTGGTAGTTAACCTGG - Intergenic
937892098 2:126946729-126946751 AACCTGGGTGGTAGTTAACCTGG - Intergenic
937892106 2:126946762-126946784 AACCTGGGTGGTAGTTAACCTGG - Intergenic
937892125 2:126946861-126946883 AACCTGGGTGGTAGTTAACCTGG - Intergenic
938502501 2:131837440-131837462 ACCCTGGGTGGTGGTGACAGTGG - Intergenic
938637522 2:133245532-133245554 GACCTGGGTGCTAATTACATAGG + Intronic
938829804 2:135039077-135039099 GGCCTGGGTGTTGGGTACACAGG + Intronic
938981648 2:136532697-136532719 GAGCTGGGTAGAGGTTACACTGG + Intergenic
940456180 2:153903838-153903860 GACCTGTGGGATGGTTACATGGG - Intronic
940754584 2:157667384-157667406 GATCTAGGTGTTGGTTACATGGG + Intergenic
942485788 2:176438570-176438592 GACCTGGGTGGTGGCTCTGCAGG + Intergenic
942571165 2:177315797-177315819 GATCTGGGTGCTGGTTACATGGG + Intronic
942589120 2:177522166-177522188 GACTGGGGTGATGGTTTCACAGG - Intronic
943764444 2:191645625-191645647 GATCTGGGTGTTGGTTACATGGG + Intergenic
944083264 2:195814105-195814127 GAGTTAGGTGCTGGTTACACAGG + Intronic
944134088 2:196379328-196379350 GATCTGGGTGGCAGTTATACAGG + Intronic
944846101 2:203669513-203669535 GATCTGGGTGGTTGTTACCTGGG - Intergenic
945510471 2:210695463-210695485 GATCTGGGTGGTAATTACATGGG - Intergenic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
947559713 2:231137978-231138000 GAATTGGGTACTGGTTACACAGG - Intronic
947717253 2:232347755-232347777 GATCTGGGTGGCGGTTACTTTGG - Intergenic
948930139 2:241126786-241126808 GACCTGTGCGGTGGCTGCACGGG - Exonic
1169230655 20:3886868-3886890 GATCTGGGTGGGGGTTACATGGG - Intergenic
1169270052 20:4192260-4192282 GATCTGGGTGGCGGTTGCATGGG + Intergenic
1169277221 20:4241982-4242004 GACCTGGGTAGTGATGACATTGG - Intronic
1169281450 20:4270747-4270769 GATTTGGGCGATGGTTACACAGG - Intergenic
1169998389 20:11585545-11585567 GTTCTGGGTGCTGGTTACATGGG + Intergenic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1170480456 20:16760315-16760337 CACCTGGGTGGGTGTTTCACGGG - Intronic
1170584814 20:17726618-17726640 GATCTGGGTAGTGGGTACATAGG - Intronic
1171380276 20:24729394-24729416 CACATGGGTGGTGGTTATATGGG + Intergenic
1171519452 20:25764815-25764837 ACCCTGGGTGGTGGTGACAGTGG - Intronic
1171557467 20:26091676-26091698 ACCCTGGGTGGTGGTGACAGTGG + Intergenic
1172041444 20:32049392-32049414 GATTGGGGTGGTGGTTACACAGG + Intergenic
1172202332 20:33135355-33135377 GATCTGGGTGGTGGTTGCAAGGG - Intergenic
1172310755 20:33916479-33916501 GACCTGGGTTGGAATTACACAGG - Intergenic
1172422556 20:34829638-34829660 GATCTAGGTGGTGGTAACACAGG - Intergenic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172621867 20:36322851-36322873 GACCTTAGTGGTAGTTACAAGGG - Intronic
1172735519 20:37124357-37124379 CACCTGGGAGCTGGTTAAACAGG + Intronic
1172848190 20:37942704-37942726 GCTCTGGATGGTGGTTACACAGG + Intronic
1173075630 20:39816742-39816764 GTTCTGAGTGGTGGTTACATAGG - Intergenic
1173705265 20:45105675-45105697 GTCCTGGGTGGTAGTTACAATGG - Intergenic
1173839480 20:46148015-46148037 GACATGGATGGTGGTCACACAGG - Intergenic
1174523503 20:51153346-51153368 GACCCGGGTTGGGGTTGCACAGG + Intergenic
1174530095 20:51204881-51204903 GATCATGGTGGTGGTTACATGGG - Intergenic
1175230128 20:57468631-57468653 GATCTGGGTGCTGCTTACCCAGG - Intergenic
1175273849 20:57754167-57754189 GTTCTGGGAGATGGTTACACAGG - Intergenic
1175517114 20:59576921-59576943 GAGCTGGTTGGTGGTTACAAAGG + Intergenic
1175881966 20:62264663-62264685 GAGCTGGGTGGTGGGTCTACAGG - Intronic
1176898770 21:14415779-14415801 GATCAGTGTGGTGGTTACACAGG + Intergenic
1177883534 21:26721872-26721894 GACCCCTGTGGTGATTACACTGG - Intergenic
1178240789 21:30897806-30897828 CCCCTGAGCGGTGGTTACACTGG + Intergenic
1178295283 21:31404764-31404786 AAGCTGGGTGGTGGGTACCCAGG + Intronic
1178691001 21:34749843-34749865 GATCTGGGTAGTGGTTACATGGG - Intergenic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1178912376 21:36685806-36685828 GATCTGGGTGGTGGTTATATGGG - Intergenic
1179248433 21:39653035-39653057 GATCTCGGTGGTGATTACATGGG - Intronic
1179435005 21:41355749-41355771 GACCATGGTGATGGTTGCACAGG + Intronic
1180909751 22:19441132-19441154 AGCCTGACTGGTGGTTACACAGG - Intronic
1181544644 22:23595043-23595065 GACCTGGGTGGTGGAGACCCTGG - Intergenic
1181568705 22:23754789-23754811 GATCTGGGTGGAGGTTGCAGGGG - Intergenic
1181750043 22:24982887-24982909 GGCCTGGGTGCTGGTTTCCCTGG + Intronic
1181815669 22:25434852-25434874 GACCTGGGTGGTGGAGACCCTGG + Intergenic
1182064669 22:27421817-27421839 GCGCTGGCTGGTGGTTACATGGG - Intergenic
1182347487 22:29676939-29676961 GATCTGGGTGCTGGGTACATGGG - Intronic
1183497969 22:38160949-38160971 GATTCGAGTGGTGGTTACACAGG + Intronic
1184443485 22:44533424-44533446 GATCTGGGTGCTGGATACATGGG + Intergenic
1184558000 22:45243595-45243617 GATCTGGGGGCTGGTTACACGGG + Intergenic
1184605752 22:45573818-45573840 GACCTGGGTGGTGATTATAAAGG + Intronic
1184704351 22:46200218-46200240 AACCTGGGTGGTGTGTACATGGG + Intronic
1184796210 22:46734557-46734579 GATCCGGGTGATGTTTACACAGG + Intronic
949458898 3:4269060-4269082 GATCTGGGTGGTGTTTCCAGAGG - Intronic
949625216 3:5858123-5858145 GATCTGGGTGGTGGTTATATAGG + Intergenic
950634616 3:14306079-14306101 GATCCGGGTGGTGGCTCCACGGG + Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
950762795 3:15248592-15248614 GATCTGGGTGATGGTTACCCAGG + Intronic
951196154 3:19826040-19826062 TACCTGGGTGGTGGTTATGCAGG - Intergenic
951339661 3:21469092-21469114 GACTAAGGTGATGGTTACACTGG + Intronic
951425301 3:22537775-22537797 GATCTGGGTGGTGACTACACAGG + Intergenic
951520589 3:23607452-23607474 GCTTTGGGTGGTGGTTACACAGG - Intergenic
951524392 3:23639957-23639979 GAGCTGGGTGGGGGTGACAGAGG + Intergenic
951843487 3:27060519-27060541 GACCTGGGCAGTGGTTTCATGGG + Intergenic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
952329676 3:32352749-32352771 GATTTGGATGCTGGTTACACAGG + Intronic
952334233 3:32391442-32391464 GATCTGGGCGACGGTTACACAGG + Intergenic
952424862 3:33165420-33165442 GACCTGGGTGCCGATTACATGGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952476557 3:33717190-33717212 GGTCTGGGTAGTGTTTACACAGG + Intronic
952493981 3:33900004-33900026 GATATGGGTGGTGATTCCACAGG - Intergenic
952589932 3:34939624-34939646 CACCTAGGTTGTGGTTACAAAGG + Intergenic
952769528 3:36985361-36985383 GACCTGGGTGGTGCATTCAAGGG + Intergenic
953051277 3:39346305-39346327 GATCTGAGTAGTGGTTACACAGG + Intergenic
953111001 3:39938079-39938101 GATCTGTGTGCTGGTTACACAGG - Intronic
953386384 3:42508542-42508564 GACCTGGGCAGTGGTGACACAGG - Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953486753 3:43305958-43305980 AAGTTGGGTGGTGGGTACACAGG + Intronic
953534033 3:43763770-43763792 CATCTGGGTGCTGGTTACATAGG + Intergenic
953603219 3:44387954-44387976 AATCTGGGTGGAGGTTACATGGG - Intronic
953648843 3:44781198-44781220 GATCTGGTTAGTGGTTATACAGG - Intronic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
953769039 3:45764840-45764862 GACCTAGGTGGTGGTTCCTTGGG + Intronic
953890249 3:46746124-46746146 AACCTGGGTGGTGATAACACAGG + Intronic
954165850 3:48757334-48757356 GATCTAGGAGGTGGTTATACAGG - Intronic
955301119 3:57780548-57780570 GATCTGGGTGGTAGTTACAAGGG + Intronic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
955486806 3:59442741-59442763 AAACTGGGTGGTGGGTCCACAGG - Intergenic
956117804 3:65935919-65935941 CACCTGGGTGGTGGTTGAGCTGG - Intronic
956729158 3:72180805-72180827 GAGCTGGGTGGTGGTTGCATAGG + Intergenic
959087897 3:101870539-101870561 TGACTGGGTGGTGGTTACATAGG - Intergenic
960123985 3:113977726-113977748 GACCTCAGTGGTGGTAACAAAGG + Intronic
960433751 3:117600852-117600874 GACCTGGTTGGTGGTTGGAGTGG + Intergenic
960646520 3:119890632-119890654 GACCAGGGTAGTGGTTATATGGG + Intronic
960791635 3:121438048-121438070 GCCCTGAGTGGTAGTTACACAGG + Intronic
960848964 3:122032051-122032073 GTCCTGAGTGGTGGTTGCAAAGG - Intergenic
961035005 3:123636099-123636121 GATCCGGGTAGAGGTTACACAGG + Intronic
961072771 3:123950699-123950721 GATCTAGGTGGTGGCTACAGGGG + Intronic
961527181 3:127512483-127512505 GACCTGGTTGGTGGCTTCATGGG + Intergenic
961537997 3:127581515-127581537 GATCCAGGTGGTGGGTACACAGG + Intronic
961855984 3:129871586-129871608 GAGCTTAGTTGTGGTTACACGGG - Intronic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
962557483 3:136570132-136570154 CATCTTGGTTGTGGTTACACAGG - Intronic
963870462 3:150409394-150409416 CACCTGGGCCGTGGTGACACTGG - Exonic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965284707 3:166804368-166804390 GACCTGGGTGAAGAATACACAGG + Intergenic
965657422 3:171003021-171003043 GATCTGGGTGCTAGTTACATAGG - Intronic
965929294 3:174022884-174022906 GAGCTGGGTGTTGCTTACAAAGG + Intronic
966026550 3:175290516-175290538 GACTTTGGTGGTGGTTACATGGG + Intronic
966450548 3:180055462-180055484 GAGCTGGACGCTGGTTACACAGG + Intergenic
966473044 3:180313534-180313556 GACTTGGGTGGTGATTACAGGGG + Intergenic
966681768 3:182649179-182649201 GATTGGGGTGGTGGTTACATAGG + Intergenic
966907245 3:184535825-184535847 GACTTGTGTGTTGGTTACATAGG + Intronic
967302190 3:188025721-188025743 CACTTGGGTGGGGCTTACACTGG - Intergenic
967536616 3:190611696-190611718 GACCTGACTGATGGTTACAAAGG + Intronic
967672301 3:192251895-192251917 TATCTGGATAGTGGTTACACAGG + Intronic
967717523 3:192779552-192779574 GACCTCAGTGGTGGTTAAATGGG + Intergenic
968198209 3:196728236-196728258 GACCTAGGTGGTAGTTACAAGGG + Intronic
968854882 4:3112353-3112375 GACCTGGGTGGCGGTTACAAGGG - Intronic
968971987 4:3800679-3800701 GCCCTGGCTGGGGGTTCCACAGG + Intergenic
969076294 4:4580896-4580918 GATCTGAGTGGTGGTTCCAAGGG - Intergenic
969713264 4:8856579-8856601 GATGCGGGTGGTGGCTACACGGG + Intronic
970339572 4:15091117-15091139 GACCTGGGTGGAGATTACATTGG - Intergenic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
972456176 4:39257908-39257930 GATCTGGGTGGGGGGTACACAGG - Intronic
972578478 4:40373789-40373811 GACCCGGATGGTGGTTACGTAGG + Intergenic
972593346 4:40508753-40508775 AATCTGGGTGGTGGTTCCACAGG + Intronic
973639583 4:52889713-52889735 GGTCTGGGTACTGGTTACACTGG - Intronic
975540699 4:75507971-75507993 GATCTGGGTAGTGGTTACAAAGG + Intronic
975547054 4:75570556-75570578 GGTCTGGGTGGTGGTCACAGGGG + Intergenic
975558726 4:75689972-75689994 GATCTGTGTGCTGGTTACATGGG + Intronic
976544123 4:86314239-86314261 GACCTGTTTGGTGGATACATAGG + Intronic
976733427 4:88286409-88286431 GATCTGGGTGCTGGATACAAAGG - Intergenic
977131232 4:93240876-93240898 GACCTGGTTAGTGGTTAAATTGG - Intronic
977790881 4:101101719-101101741 GATCTGGGTAGTGGTTTCATGGG - Intronic
977923031 4:102666820-102666842 GCACTGGGTGGTGGCTACAAGGG - Intronic
978060580 4:104332399-104332421 GTTCTGGGTTGTGGTTACATAGG - Intergenic
979482329 4:121234447-121234469 GATGTGGGTGCTGGTTACGCTGG - Intergenic
979587362 4:122436691-122436713 AAGCTGGGTGCTGGGTACACAGG - Intergenic
981017453 4:139988689-139988711 GACTGGGGTGGTGGTTATAAGGG + Intronic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
981305589 4:143243871-143243893 TATCTGTGTGGTAGTTACACAGG - Intergenic
981590812 4:146358455-146358477 GATTTGGGTGATGGTTACCCAGG - Intronic
981807422 4:148732829-148732851 GACCTGGGTGTTGGTTACACAGG - Intergenic
982041474 4:151401227-151401249 GATCTGGGTGCTGATTACATGGG + Intergenic
982130682 4:152226199-152226221 GATTAGGGTGTTGGTTACACAGG - Intergenic
982217746 4:153096826-153096848 AAGCTGGGTGGTGGGTACGCAGG - Intergenic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
983186244 4:164704381-164704403 GACATGGGTGGTGGATATATGGG + Intergenic
983264476 4:165493521-165493543 GAGCTGGGAGGTGGTGCCACAGG + Intronic
983301831 4:165935535-165935557 GACTTGGGTGGTAGTTACATGGG - Intronic
983667834 4:170202108-170202130 GACCTGGGTTCTGGGTTCACAGG - Intergenic
983772194 4:171564842-171564864 TATCTGGGTGCTGGTAACACAGG + Intergenic
984043148 4:174762809-174762831 GATCTGGGTAGTAGTAACACAGG - Intronic
984219797 4:176959560-176959582 GCAATGTGTGGTGGTTACACAGG + Intergenic
984818778 4:183861892-183861914 CACCTGGATGGTGGTTACGTGGG - Intronic
984987631 4:185346865-185346887 GGACTGGGTGCTGGTTACATGGG - Intronic
985092671 4:186380420-186380442 AACCTGGGTGATGGAAACACAGG + Intergenic
986374980 5:7121822-7121844 GACCTGGGAGGTGATGACAAGGG + Intergenic
986608297 5:9544996-9545018 CACCTGGCTGGTGGTTCCCCAGG + Intronic
987138682 5:14922847-14922869 GAACTCGGTGGTGGTTGCAGTGG + Intergenic
987144066 5:14974535-14974557 GACCTGGGTTGTGGTTGCTCAGG + Intergenic
987206976 5:15638082-15638104 CACCTGGGGGGTGGTGACATTGG - Intronic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
987827567 5:23053297-23053319 GACCTGAGTGTTATTTACACAGG + Intergenic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
988979454 5:36552061-36552083 GACTGTGGAGGTGGTTACACAGG + Intergenic
989129354 5:38090601-38090623 GATCAGGTTGATGGTTACACAGG + Intergenic
989227306 5:39044179-39044201 GATCTGGGTGCTGGTTTCACAGG + Intronic
990104389 5:52238809-52238831 GATTTGGGTAGTGGTTACAAGGG - Intergenic
990178344 5:53132254-53132276 GATCTGTCTGGAGGTTACACAGG - Intergenic
990772438 5:59263883-59263905 AATCTGGGTGGTGATTACAGGGG + Intronic
991225272 5:64263169-64263191 CACCTGGTTGGTGGTTAGTCTGG + Intronic
991446992 5:66710939-66710961 AATATGGGTGCTGGTTACACGGG - Intronic
991588318 5:68222240-68222262 GGTAGGGGTGGTGGTTACACAGG + Intronic
991947457 5:71913514-71913536 AAGCTGGGTGGTGGGTACAAGGG - Intergenic
992133090 5:73714741-73714763 GCTCTGGGTGATGGTGACACAGG - Intronic
992171994 5:74112000-74112022 GATCTGGGTGGTGGTTGTATGGG + Intergenic
992383190 5:76258758-76258780 GATTTGGGTGGTGGTTACATGGG - Intronic
992434491 5:76742218-76742240 TACCTGGGAAGTTGTTACACAGG - Intergenic
992888947 5:81186271-81186293 GACCTGGGTGGCAGTTACATGGG - Intronic
993029746 5:82692185-82692207 AATCTAGGTGGTGGTTACCCAGG - Intergenic
995460618 5:112399373-112399395 AACCTGGATGGTGATTACACAGG - Intronic
995731717 5:115250737-115250759 GAGCTGAGTGCTGGTTATACAGG - Intronic
997138674 5:131354310-131354332 GACCTGGGTGGTAGCTACACAGG - Intronic
997489864 5:134264668-134264690 GCTTTGGGTGGTGGTTACATGGG + Intergenic
997558899 5:134827146-134827168 GATCTGGGTAGTGACTACACTGG - Intronic
997705726 5:135950496-135950518 GATTTGGGTGCTGATTACACAGG + Intronic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998182094 5:139952924-139952946 CCCCTGGGTGGGGGTTGCACAGG + Intronic
998244382 5:140484938-140484960 CCTCTGGGTGCTGGTTACACAGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
999431724 5:151530842-151530864 AAGCTGGGTGGTGGGAACACAGG + Intronic
999547982 5:152652114-152652136 AATCTGGGTGGTGATTACACAGG - Intergenic
1000422198 5:161051000-161051022 GATCTGGGTAATGGTTACATGGG + Intergenic
1000721796 5:164717403-164717425 GATCTGGATGCTAGTTACACTGG - Intergenic
1000729715 5:164818388-164818410 AATCTAGGTGGTGATTACACAGG + Intergenic
1000847429 5:166299321-166299343 GTTCTGGGTGGTGGTTACGAGGG + Intergenic
1001442453 5:171754543-171754565 GACCTGGGTATTGGTTACCCAGG + Intergenic
1001444035 5:171769366-171769388 GAACTGGGTGATGGTTACAAGGG + Intergenic
1002120753 5:177002408-177002430 TACCTTGGTGGTACTTACACGGG + Intronic
1003507028 6:6748589-6748611 GACTTGGGTGGCGGTTGCAGAGG + Intergenic
1003619550 6:7686314-7686336 GACCTGGGTGGTATTTACCCAGG + Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1003653077 6:7979368-7979390 GACGTGGGTGATAGTTACACAGG - Intronic
1003667394 6:8124222-8124244 GATCTGGGTGCTGGTTACGCAGG - Intergenic
1004077360 6:12356761-12356783 GATCTGGGTTGTGGCTACATGGG + Intergenic
1004323965 6:14656742-14656764 GTTCTGGGTGATGGTTACTCGGG - Intergenic
1004563845 6:16777235-16777257 AACCTGGGTGGTGGTCACAGAGG + Intergenic
1004868276 6:19875868-19875890 GATATGGGTGCTGGCTACACAGG - Intergenic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1005163015 6:22887016-22887038 AATCTGAGTGGTGATTACACAGG - Intergenic
1005329846 6:24739205-24739227 GAGCTAGGTGGTGATTATACAGG + Intergenic
1006010236 6:31036823-31036845 GATCTGGGTGGTGATTACAAGGG + Intergenic
1006497618 6:34435155-34435177 GACTTGGGTGGTGATTACAAGGG - Intergenic
1006669237 6:35719379-35719401 GATCTAGGTGATGGTTACATGGG + Intronic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1006995695 6:38257876-38257898 GATCTGAGTGGTAGTTACACGGG + Intronic
1007082233 6:39115793-39115815 CATCTGGGTGGTAGTTACACAGG - Intergenic
1008119182 6:47591308-47591330 GGCCTATGTGGTGGTTACTCTGG + Intronic
1008157902 6:48039519-48039541 AACCTTGGTGGTGTTTACATGGG + Intronic
1008178289 6:48294961-48294983 CACCTGGGTGGTGGTTATATGGG - Intergenic
1008310320 6:49961710-49961732 GACTTGGGTAGTGTTTACATAGG - Intronic
1008423171 6:51326606-51326628 GACCTGAGTAGTGGTTATATTGG + Intergenic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1008592525 6:53008747-53008769 AAGCTGGGTGATGGCTACACAGG + Intronic
1008980682 6:57480348-57480370 GAACTGGGTGAAGGATACACTGG - Intronic
1009168784 6:60373299-60373321 GAACTGGGTGAGGGATACACTGG - Intergenic
1009950518 6:70390081-70390103 GACTTGGATGGTGGTTAAATGGG + Intergenic
1010046339 6:71448440-71448462 GATCTGAGTGTTGGTTACACAGG + Intergenic
1010244659 6:73652000-73652022 AATCTGGGTGCTGGTTACATGGG + Intronic
1010674582 6:78726943-78726965 GAACTTGGTGATGGTTACATGGG - Intergenic
1011926899 6:92656470-92656492 GGCCTGGATGGTGTTTACATGGG + Intergenic
1012286725 6:97399382-97399404 GTGCTGGGTGGTGGTGGCACTGG + Intergenic
1012704299 6:102501695-102501717 GAGATGGGTGGTGGTGATACTGG - Intergenic
1013313531 6:108919970-108919992 GAGCTGGATGATGGGTACACAGG - Intronic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1013471632 6:110471735-110471757 GATTTGGGTGGGGGTAACACAGG + Intronic
1013499380 6:110732748-110732770 ATCTTGGTTGGTGGTTACACAGG - Intronic
1013601898 6:111712798-111712820 GACCTGGCTGGTGGCCACACAGG + Intronic
1014194404 6:118536366-118536388 GACCTGAGTGGTGATTATAAGGG + Intronic
1014800565 6:125773163-125773185 AAGCTGGGTGGTGGGTACAAAGG - Intergenic
1015767204 6:136731188-136731210 GATCTAGGTGCTGGTTACTCTGG + Intronic
1015807511 6:137126347-137126369 GATCTGGGCAGTGGTTACACAGG + Intergenic
1015940666 6:138448475-138448497 GAACTGGGTGCTGGTTGTACAGG - Intronic
1015944951 6:138490068-138490090 GACCTAGGTAATGGTTATACAGG + Intronic
1015948192 6:138524314-138524336 GATCTGGGTGCTGGTTACATGGG - Intronic
1016537083 6:145119549-145119571 GATCTGAGTAGTGCTTACACAGG - Intergenic
1016755730 6:147684043-147684065 GATCTGGATGGTGGTGACATGGG - Intronic
1017916721 6:158836914-158836936 GAAGAGGGTGGTGGGTACACCGG - Intergenic
1018240874 6:161773146-161773168 GATCCAGGTGGTGGTTACAGAGG + Intronic
1018932216 6:168248498-168248520 GTCCTGGGCGGTGGTGAAACCGG + Intergenic
1019882888 7:3878915-3878937 GACCTGAGTGGCGATTACACAGG - Intronic
1020811983 7:12859052-12859074 GATCTGTATGGTGGTTACATAGG - Intergenic
1021154587 7:17194449-17194471 GATCTGGGTGCTGGTTACATAGG + Intergenic
1021634989 7:22683240-22683262 GATTTGGGTAGTGGTTACACAGG + Intergenic
1021801640 7:24312974-24312996 GACCCGGGTGGTAGTTACATGGG + Intergenic
1021826275 7:24555397-24555419 CACCTTGCTGGTGGTTACACAGG + Intergenic
1021843836 7:24745157-24745179 CACCTGGATAGTGGTTAAACAGG - Intronic
1022015911 7:26348098-26348120 GATCTGAGTGGTAGTTACACAGG - Intronic
1022786896 7:33647322-33647344 GCTGTGGGTGCTGGTTACACGGG - Intergenic
1022896441 7:34754468-34754490 GATTTGGGTGCTAGTTACACTGG - Intronic
1022910154 7:34893022-34893044 AAGCTGGGTGGTGGGCACACAGG + Intergenic
1022948316 7:35310410-35310432 GACCTGGGAGATGGTTACACTGG + Intergenic
1023667469 7:42539431-42539453 GATATGGGTGGGGGTTACATGGG + Intergenic
1024039188 7:45536591-45536613 GATTTGAGTGGTGGTTACATGGG + Intergenic
1024272840 7:47655436-47655458 GACCTGGGAAGTGGTTACATGGG + Intronic
1024358220 7:48440201-48440223 AATCTGGGTGGTGGTTACGCAGG - Intronic
1025279937 7:57619755-57619777 ACCCTGGGTGGTGGTGACAGTGG - Intergenic
1025304797 7:57845746-57845768 ACCCTGGGTGGTGGTGACAGTGG + Intergenic
1025726206 7:64063895-64063917 GCTCTGGGTGGTGGTGACAATGG - Intronic
1026016458 7:66674851-66674873 GATCTAGGTGGTGGTTGGACGGG + Intronic
1026091439 7:67303785-67303807 AACCTGGGAGGTGGTGACCCTGG - Intergenic
1026176211 7:67999730-67999752 GACCTAAATGGTGATTACACTGG - Intergenic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1026659453 7:72287106-72287128 AATCTGGGTGGTGGGTACATGGG - Intronic
1026744928 7:73004369-73004391 AACCTGGGAGGTGGTGACCCTGG + Intergenic
1026814818 7:73502409-73502431 AACCTGTATGGTGGGTACACAGG - Intronic
1026973608 7:74482605-74482627 GATCTGGGTGCTGGTTACCTGGG - Intronic
1027098812 7:75360713-75360735 AACCTGGGAGGTGGTGACCCTGG - Intergenic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1028067635 7:86407089-86407111 GAGCTGTGTGATGGGTACACAGG + Intergenic
1028417062 7:90592061-90592083 GACCTGAGTTGTGAATACACTGG + Intronic
1028537076 7:91901576-91901598 AAATTGGGTGGTGGTTTCACTGG + Intergenic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1029399911 7:100337516-100337538 AACCTGGGAGGTGGTGACCCTGG - Intronic
1029593320 7:101521708-101521730 AATGTGGGTGCTGGTTACACAGG - Intronic
1029716946 7:102333986-102334008 AACCTGGGAGGTGGTGACCCTGG + Intergenic
1029841502 7:103368947-103368969 GGATTTGGTGGTGGTTACACAGG - Exonic
1029908070 7:104112354-104112376 GATCTGAGTAGTGGTTACACTGG - Intergenic
1029925015 7:104306322-104306344 GAGTTGAGTGGTGGTTACTCAGG + Intergenic
1031509284 7:122628348-122628370 GATCTGGGAGGTGGCTACACAGG + Intronic
1031938107 7:127757027-127757049 GATTTGGGTGGTAGATACACTGG - Intronic
1032671268 7:134084622-134084644 GGCCTGGCAGGTGGTTACAAAGG + Intergenic
1033236755 7:139644256-139644278 CACCTGGCTGGTAGTGACACTGG - Intronic
1033328763 7:140400795-140400817 GCCCTGAGTGGTGGTGACACAGG - Intronic
1033803430 7:144927426-144927448 GATCTGGATAGTGGTTACATGGG - Intergenic
1034354232 7:150439140-150439162 GAGCTGGGTGTTGAGTACACGGG + Intergenic
1034400976 7:150861201-150861223 GAACTGGGGGCTGGTCACACAGG - Exonic
1035546155 8:483722-483744 GCCCAGGGTGGTGCTTCCACTGG - Intergenic
1035567991 8:654452-654474 GATCTGGGTGTGGGTTACAGGGG + Intronic
1035878107 8:3213393-3213415 CACCTAGGTGGTGGTTTCATGGG - Intronic
1036177104 8:6549601-6549623 GAGTTGGGCGGTCGTTACACAGG + Intronic
1036177119 8:6549690-6549712 GAGCTGGGCGGTCATTACACAGG + Intronic
1036177134 8:6549781-6549803 GAGCTGGGTGGTCATTGCACAGG + Intronic
1037914979 8:22767672-22767694 GATCTCGGTGGTGGTTACTTGGG + Intronic
1038457741 8:27688866-27688888 GACCTGGGTGAAGGTTACACAGG + Intergenic
1038574867 8:28696298-28696320 GAGCTGGGTGCTGGGTTCACAGG - Intronic
1038655067 8:29443297-29443319 TACCTGGGTGGTGGTTAAATGGG + Intergenic
1039307306 8:36276529-36276551 GATCTGGGTGGTGGTTATGAGGG + Intergenic
1041412602 8:57573270-57573292 GACATGGCTGGTGGGGACACAGG + Intergenic
1041412769 8:57575002-57575024 GACGTGGCTGGTGGGGACACAGG + Intergenic
1041930017 8:63276525-63276547 AATCTGGGTGGTAGTTACACAGG - Intergenic
1042005715 8:64177810-64177832 TCCCTGGGTACTGGTTACACTGG + Intergenic
1042139588 8:65664493-65664515 GATCTAGGTGGTGGTTACAAAGG + Intronic
1044091361 8:88006393-88006415 GAACTGGGTGGAGGTTGCAGAGG + Intergenic
1044902587 8:96963757-96963779 GATCTGGGTAGCAGTTACACAGG - Intronic
1045351989 8:101349912-101349934 AACCTGAGTGGTAGGTACACAGG + Intergenic
1045955837 8:107905647-107905669 TGCCAGGTTGGTGGTTACACAGG - Intronic
1046544537 8:115632891-115632913 GACATGAGTGATAGTTACACAGG + Intronic
1046825005 8:118679315-118679337 GACCTGGGTGTGGGATACATGGG - Intergenic
1046942690 8:119946402-119946424 TATTTGGGTGGTGGTTCCACAGG - Intronic
1047560531 8:125983252-125983274 GATCAGGGTGGTGGTTACTGAGG - Intergenic
1047676103 8:127204935-127204957 GACTTAGGTAGTGGTTACACAGG + Intergenic
1047873092 8:129106665-129106687 GACATAGGTGTTGGATACACAGG - Intergenic
1048011793 8:130463305-130463327 GAACAGAGTGGTGGTTACATAGG + Intergenic
1049429379 8:142552195-142552217 GTGCTGGGTGGTGGTTACAAAGG - Intergenic
1050656181 9:7831248-7831270 GAAATGGATGGTGGTTACACAGG - Intronic
1050856729 9:10366959-10366981 GACCTGGGTGGTGAATACATGGG + Intronic
1051115235 9:13686797-13686819 GATCTAGGTGGTGCTTACACAGG + Intergenic
1052082415 9:24223513-24223535 CACCTGTGTGGTGGTTACACAGG + Intergenic
1052322980 9:27188263-27188285 AATCTGAGTGGTGGTTACATGGG + Intronic
1053111630 9:35465595-35465617 AAGCTGGGTGATGGGTACACGGG + Intergenic
1053242588 9:36508188-36508210 GATCTGTGTGGTGGTTACATGGG + Intergenic
1053336034 9:37272430-37272452 GACCCGGGTGATGGTTACATAGG - Intronic
1053344532 9:37368703-37368725 GACATGGTAGGTGGTTACATCGG + Intergenic
1053509406 9:38674848-38674870 GACCTAGGTGATGGTTACACAGG + Intergenic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1055028046 9:71743330-71743352 GACCTGGGTGGTGGCTACACAGG + Intronic
1055326115 9:75131903-75131925 GATCTGGGTGTTGGTTACGTGGG - Intronic
1055468214 9:76586224-76586246 TATCTTGGTGGTGTTTACACAGG - Intergenic
1056082303 9:83108144-83108166 GATCTGGGTAGTGTTTACATGGG + Intergenic
1056265526 9:84893100-84893122 GACAGGGGTTATGGTTACACAGG - Intronic
1056584965 9:87921805-87921827 CACCTGGGCTGTGTTTACACAGG - Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1057936682 9:99245762-99245784 GGCCTGAGTGGTGGTTACACAGG - Intergenic
1058146089 9:101413096-101413118 AAGCTGAGTGCTGGTTACACAGG - Intergenic
1058941648 9:109818448-109818470 TAACTGGGTGGTGATTACAAAGG + Intronic
1059184061 9:112249277-112249299 AACCTGGGTGGTAGTCACATGGG + Intronic
1059391763 9:114003725-114003747 GAGCTGGGTGCTGGTTACCTGGG + Intronic
1059837063 9:118167237-118167259 AATCTGTGTGGTGGTTACATGGG - Intergenic
1059865606 9:118510807-118510829 GATTTTGGTGGTGCTTACACAGG - Intergenic
1060672525 9:125482236-125482258 GATCTGGGTGCTGATTACATGGG - Intronic
1061187889 9:129065678-129065700 AACCTGGGTGCTGGTTATACAGG - Intronic
1061310147 9:129756687-129756709 GTCCTGGGTGGTGATTACCCAGG + Intergenic
1062672598 9:137720234-137720256 GGTCTGGTTGGTGGCTACACAGG - Intronic
1062676387 9:137747746-137747768 GATCTGGGTGGTGGCCACACAGG - Intronic
1186521470 X:10210382-10210404 GTCCTGGGTGCTGGTTACACAGG - Intronic
1186639755 X:11443050-11443072 GATTTGGGTGGTCGTTATACAGG - Intronic
1186691342 X:11979054-11979076 TATCTGGGTGGTGGGTACATGGG - Intergenic
1186762813 X:12741011-12741033 AACCTGATTGGTGATTACACAGG + Intergenic
1187312362 X:18157539-18157561 GATCTGGGTAGTTGTCACACAGG - Intergenic
1187387019 X:18858223-18858245 GATCTGGGTGCTGGTTACGTGGG - Intergenic
1187428258 X:19198115-19198137 GATTGGTGTGGTGGTTACACTGG - Intergenic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1187499793 X:19830301-19830323 GATCTGGGTGGTGGTTATAGAGG + Intronic
1187687370 X:21828914-21828936 GAGATGGGTGGTGGTGACACAGG + Intergenic
1187945575 X:24423437-24423459 CAGCTGAGTGCTGGTTACACAGG - Intergenic
1187947605 X:24441638-24441660 GATCTGGGTGCTGGCTACCCAGG + Intergenic
1188099448 X:26065401-26065423 GCTTTGGGTGGTGGTTACATGGG + Intergenic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189275694 X:39784202-39784224 GTCCTGAGTGCTGGTTACACAGG + Intergenic
1189452115 X:41145681-41145703 TACCTGGGTACTAGTTACACAGG + Intronic
1189488638 X:41452271-41452293 GATTGGGGTGGTGGTTACACAGG + Intronic
1189751063 X:44223356-44223378 GTCATGGGTGGTGGTAACAGAGG + Intronic
1189899053 X:45687107-45687129 GACCTGGGTGATGGTTACTAGGG - Intergenic
1189912017 X:45819715-45819737 GACTTCAGTGGTGGTTAGACAGG + Intergenic
1190049563 X:47139731-47139753 GACCTGAGTGCTGGTTATATGGG + Intergenic
1190146559 X:47896664-47896686 AATAGGGGTGGTGGTTACACTGG - Intronic
1190524924 X:51319361-51319383 GTTTTGGGTTGTGGTTACACAGG + Intergenic
1190545305 X:51519531-51519553 GTTTTGGGTTGTGGTTACACAGG - Intergenic
1191183914 X:57590564-57590586 GACCTTGGTCCTGGTTACACAGG + Intergenic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1192451748 X:71249292-71249314 AAGCTGGCTGGTGGATACACAGG - Intronic
1192506762 X:71690451-71690473 GATCTGGATGGCGGTTACATGGG + Intergenic
1192513176 X:71738589-71738611 GATCTGGATGGCGGTTACATGGG - Intergenic
1192513521 X:71742924-71742946 GATCTGGATGGCGGTTACATGGG + Intergenic
1192519935 X:71791095-71791117 GATCTGGATGGCGGTTACATGGG - Intergenic
1192531225 X:71888339-71888361 GACCTGTGTGTTGATTACAAAGG - Intergenic
1192566107 X:72164837-72164859 GACCTGCATGGTAGTCACACTGG + Intergenic
1193827036 X:86239296-86239318 GACCTAGTTGCTGGCTACACAGG - Intronic
1194373010 X:93097821-93097843 GACCTGTGTGGTGGGTATAATGG + Intergenic
1194890173 X:99369245-99369267 GACCTGGCTAGTGCTTACAATGG - Intergenic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195590099 X:106614905-106614927 GAGGGGGGTGATGGTTACACAGG - Intronic
1195784382 X:108502717-108502739 GACCTGGGTGTTAGTTACAAAGG - Intronic
1195922179 X:109994747-109994769 GATCTGGGTGGTGATTACAGTGG + Intergenic
1196604383 X:117639931-117639953 AAGCTGGGTTGTGGATACACAGG + Intergenic
1196651518 X:118172992-118173014 GATGTGGGTAGTGGTTACATGGG - Intergenic
1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG + Intergenic
1197198108 X:123723917-123723939 GACCTGGGTGTAAGTTACATGGG + Intronic
1198236570 X:134741039-134741061 GATCTGGGTATTGGTTACACGGG + Intronic
1198238662 X:134762040-134762062 GACCTGGGTGATGGTTACTTGGG - Intronic
1198238693 X:134762257-134762279 GACCTGGGCGATGGTTACTTGGG - Intronic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198327129 X:135585189-135585211 GATCGGGGTGGTGGCTACTCAGG + Intergenic
1198562258 X:137863785-137863807 CATTTGGGTGCTGGTTACACTGG - Intergenic
1198799718 X:140436375-140436397 GCCCTGGGTGCTGGTTTCATAGG + Intergenic
1198814217 X:140570166-140570188 GCCCTGGGTGTTGGTTACACAGG + Intergenic
1199758299 X:150885226-150885248 GACCTGGTCGGTGGTGACACAGG + Intronic
1199794969 X:151185589-151185611 GATATGTGTGGTGGTTACATGGG - Intergenic
1199880622 X:151971942-151971964 GATCTAGGTGTTGGTTACACGGG + Intronic
1200313725 X:155107988-155108010 GATCTGGGTTGTGGTTGCATAGG - Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1200681051 Y:6211859-6211881 GACCTGGGTGGTGGGTATAATGG + Intergenic
1202299320 Y:23394926-23394948 GATTTGGGTAGTGGTTATACTGG - Intergenic
1202571489 Y:26275672-26275694 GATTTGGGTAGTGGTTATACTGG + Intergenic