ID: 920057821

View in Genome Browser
Species Human (GRCh38)
Location 1:203205689-203205711
Sequence TTGGCTCCATAACATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920057821_920057831 16 Left 920057821 1:203205689-203205711 CCTGGCTCATGTTATGGAGCCAA No data
Right 920057831 1:203205728-203205750 GGGTTGGGTGAAGTAGCTCTGGG No data
920057821_920057830 15 Left 920057821 1:203205689-203205711 CCTGGCTCATGTTATGGAGCCAA No data
Right 920057830 1:203205727-203205749 AGGGTTGGGTGAAGTAGCTCTGG No data
920057821_920057824 -4 Left 920057821 1:203205689-203205711 CCTGGCTCATGTTATGGAGCCAA No data
Right 920057824 1:203205708-203205730 CCAAGTCCCTTCATACTCCAGGG No data
920057821_920057825 0 Left 920057821 1:203205689-203205711 CCTGGCTCATGTTATGGAGCCAA No data
Right 920057825 1:203205712-203205734 GTCCCTTCATACTCCAGGGTTGG No data
920057821_920057822 -5 Left 920057821 1:203205689-203205711 CCTGGCTCATGTTATGGAGCCAA No data
Right 920057822 1:203205707-203205729 GCCAAGTCCCTTCATACTCCAGG No data
920057821_920057826 1 Left 920057821 1:203205689-203205711 CCTGGCTCATGTTATGGAGCCAA No data
Right 920057826 1:203205713-203205735 TCCCTTCATACTCCAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920057821 Original CRISPR TTGGCTCCATAACATGAGCC AGG (reversed) Intergenic
No off target data available for this crispr