ID: 920058035

View in Genome Browser
Species Human (GRCh38)
Location 1:203206744-203206766
Sequence TCTGAGATGCAGAATGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920058035_920058037 -1 Left 920058035 1:203206744-203206766 CCTTTTTCATTCTGCATCTCAGA No data
Right 920058037 1:203206766-203206788 ATGGAGCTGCTCTCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920058035 Original CRISPR TCTGAGATGCAGAATGAAAA AGG (reversed) Intergenic
No off target data available for this crispr