ID: 920058229

View in Genome Browser
Species Human (GRCh38)
Location 1:203208232-203208254
Sequence TCAGCTCGATGCTTTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920058229_920058232 12 Left 920058229 1:203208232-203208254 CCTTAAAAAAAGCATCGAGCTGA No data
Right 920058232 1:203208267-203208289 TGACTGCTACCAAATGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920058229 Original CRISPR TCAGCTCGATGCTTTTTTTA AGG (reversed) Intergenic
No off target data available for this crispr