ID: 920058351

View in Genome Browser
Species Human (GRCh38)
Location 1:203209971-203209993
Sequence CTTGGCTTTTCATTCTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920058351_920058356 19 Left 920058351 1:203209971-203209993 CCTAAGGAGAATGAAAAGCCAAG No data
Right 920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920058351 Original CRISPR CTTGGCTTTTCATTCTCCTT AGG (reversed) Intergenic
No off target data available for this crispr