ID: 920058353

View in Genome Browser
Species Human (GRCh38)
Location 1:203209994-203210016
Sequence TGGCTAAATCTTCTGGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920058353_920058359 8 Left 920058353 1:203209994-203210016 CCTCAACCCAGAAGATTTAGCCA No data
Right 920058359 1:203210025-203210047 GTCATGAGTGGATTTGTGTTCGG No data
920058353_920058356 -4 Left 920058353 1:203209994-203210016 CCTCAACCCAGAAGATTTAGCCA No data
Right 920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG No data
920058353_920058360 15 Left 920058353 1:203209994-203210016 CCTCAACCCAGAAGATTTAGCCA No data
Right 920058360 1:203210032-203210054 GTGGATTTGTGTTCGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920058353 Original CRISPR TGGCTAAATCTTCTGGGTTG AGG (reversed) Intergenic
No off target data available for this crispr