ID: 920058356

View in Genome Browser
Species Human (GRCh38)
Location 1:203210013-203210035
Sequence GCCAAACCTGCAGTCATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920058354_920058356 -10 Left 920058354 1:203210000-203210022 CCCAGAAGATTTAGCCAAACCTG No data
Right 920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG No data
920058353_920058356 -4 Left 920058353 1:203209994-203210016 CCTCAACCCAGAAGATTTAGCCA No data
Right 920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG No data
920058351_920058356 19 Left 920058351 1:203209971-203209993 CCTAAGGAGAATGAAAAGCCAAG No data
Right 920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG No data
920058352_920058356 1 Left 920058352 1:203209989-203210011 CCAAGCCTCAACCCAGAAGATTT No data
Right 920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920058356 Original CRISPR GCCAAACCTGCAGTCATGAG TGG Intergenic
No off target data available for this crispr