ID: 920061535

View in Genome Browser
Species Human (GRCh38)
Location 1:203230062-203230084
Sequence ATGGAGAAACAGTTTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 462}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920061535_920061537 -8 Left 920061535 1:203230062-203230084 CCTCTCTCAAACTGTTTCTCCAT 0: 1
1: 1
2: 2
3: 42
4: 462
Right 920061537 1:203230077-203230099 TTCTCCATCTAGAAGATAATGGG 0: 1
1: 0
2: 0
3: 19
4: 212
920061535_920061538 -7 Left 920061535 1:203230062-203230084 CCTCTCTCAAACTGTTTCTCCAT 0: 1
1: 1
2: 2
3: 42
4: 462
Right 920061538 1:203230078-203230100 TCTCCATCTAGAAGATAATGGGG 0: 1
1: 0
2: 2
3: 15
4: 184
920061535_920061536 -9 Left 920061535 1:203230062-203230084 CCTCTCTCAAACTGTTTCTCCAT 0: 1
1: 1
2: 2
3: 42
4: 462
Right 920061536 1:203230076-203230098 TTTCTCCATCTAGAAGATAATGG 0: 1
1: 0
2: 2
3: 53
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920061535 Original CRISPR ATGGAGAAACAGTTTGAGAG AGG (reversed) Intronic
900719587 1:4166687-4166709 AGGGAGGAAAAGTCTGAGAGAGG - Intergenic
901362064 1:8710090-8710112 ACACAGAAACAGCTTGAGAGTGG - Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
904811599 1:33166575-33166597 ATGGAGAAAAAGATACAGAGAGG + Intronic
904839963 1:33366169-33366191 ATGGTAAAATGGTTTGAGAGAGG + Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905221069 1:36448134-36448156 ATGGAGAAACAGGTTTATAGAGG + Intronic
905221769 1:36452722-36452744 ATGGTGAAGCAGTTTCAGTGGGG - Intergenic
905889445 1:41510428-41510450 ATGCTGAAGCAGTTGGAGAGAGG + Exonic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906782197 1:48582732-48582754 ATCGGGAAACAGATTCAGAGTGG + Intronic
906787920 1:48632088-48632110 ATGGAGTAAAAGATTGAGTGAGG + Intronic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907644102 1:56224352-56224374 ATGGAGATAAAGTTTGTGATGGG - Intergenic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
907830149 1:58057100-58057122 AGGGAGAATCAGGTTGAGTGAGG - Intronic
907845495 1:58202284-58202306 ATGGAGAAATAATTTAAGAAGGG - Intronic
908017375 1:59857515-59857537 ATGGAGGAACAGATTTACAGAGG + Intronic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908893474 1:68872127-68872149 ATGGTGGAACAGTATGAGAGTGG - Intergenic
909887908 1:80965543-80965565 ATGGAGATAGACTTTGAGGGGGG - Intergenic
909971917 1:82001221-82001243 AGGAGGAAACAATTTGAGAGAGG - Intergenic
910221756 1:84895077-84895099 ACAGAGAAACAGATTCAGAGAGG + Intergenic
910375402 1:86563655-86563677 ATGGACAAACAGTTTGCCTGTGG - Exonic
910559222 1:88572282-88572304 ATGGAGAAGAAGTGTGAGAGGGG - Intergenic
911550331 1:99271030-99271052 ATGAAGAAACAGTAAGATAGTGG - Intronic
911994202 1:104742874-104742896 ATAGAGAAAGAGTTGGATAGAGG - Intergenic
912248387 1:107985312-107985334 ATGGTGAAACATTTTTAGATGGG - Intergenic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
913246919 1:116878435-116878457 ATGGAGTAAGGGATTGAGAGGGG - Intergenic
913428569 1:118762881-118762903 ATGGGCAAAAAGTTTTAGAGAGG + Intergenic
913613434 1:120530972-120530994 ATAGAATAAGAGTTTGAGAGAGG - Intergenic
914577751 1:148991275-148991297 ATAGAATAAGAGTTTGAGAGAGG + Intronic
917207203 1:172589273-172589295 ACTGAGAAAGAGTTTGAGAATGG - Exonic
918133465 1:181648733-181648755 ATTGAGCTACAGTTTGAGGGTGG - Intronic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918560961 1:185867184-185867206 TGGAAGAAACAGTTTTAGAGAGG + Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919516687 1:198533838-198533860 ATGAAGAAAGAGTTTCAAAGAGG + Intronic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
921854961 1:219972564-219972586 ATGGAGGTGCAGTTTGGGAGAGG - Intronic
922575351 1:226657708-226657730 ATGATGAAACATGTTGAGAGGGG + Intronic
923941204 1:238829444-238829466 ATGCAGAAATAGTATGACAGTGG - Intergenic
1063602577 10:7495755-7495777 AGAGAGAAACAGGCTGAGAGAGG + Intergenic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1068972153 10:62970473-62970495 ATGGAAAAAAAGCTTGAGTGTGG + Intergenic
1069952351 10:72027819-72027841 ATGGTAAAACAGATTCAGAGAGG - Intergenic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1071160213 10:82736650-82736672 ATGGAAAATCAGTTTAAGATGGG + Intronic
1071264472 10:83952560-83952582 ATGGTGCAACAGTGTGTGAGGGG + Intergenic
1071693254 10:87844586-87844608 GTGGAGGAACAGGTGGAGAGTGG - Intergenic
1071957855 10:90778776-90778798 ATGGAGACACATTTAGACAGTGG - Intronic
1072760688 10:98054078-98054100 AGAGAGAAACAGACTGAGAGAGG - Intergenic
1073103931 10:101021629-101021651 AAGAAGAAACAGGTTTAGAGAGG - Intronic
1073256263 10:102153407-102153429 ATGGGAAGACACTTTGAGAGAGG + Intronic
1073348841 10:102804618-102804640 ATGGACACACAGTGTGAGTGAGG - Intronic
1073698653 10:105899373-105899395 AAGGAGAAACAGGGAGAGAGAGG + Intergenic
1074371338 10:112903065-112903087 AGGGAAAAACAGATTTAGAGAGG - Intergenic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1078344908 11:10539369-10539391 ATGGAGAACTGGTTTCAGAGAGG - Intronic
1079168704 11:18071209-18071231 AAGGAAAAACAGCTGGAGAGAGG + Intronic
1079569096 11:21920921-21920943 AAGGAGAAAAATTTTGAGAAGGG - Intergenic
1080269054 11:30431390-30431412 ATTGGGAAACAGATTCAGAGAGG - Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084167949 11:67385389-67385411 AGGATGAAACAGTCTGAGAGGGG - Intronic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085279681 11:75321656-75321678 ATGAAGAAACAAGTTGAGTGAGG - Intronic
1085356206 11:75839875-75839897 AGAGAGAAAGAGATTGAGAGAGG + Intronic
1085717248 11:78883355-78883377 ATGGCTAAACAGCTGGAGAGTGG + Intronic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086353358 11:85966197-85966219 GGGGAAAAACAGTTTTAGAGAGG - Intronic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087386652 11:97479123-97479145 AAGGAAAAAGAGTTTCAGAGTGG + Intergenic
1088429950 11:109747934-109747956 ATGGAGGAAGAGTTTGTGGGAGG + Intergenic
1089029633 11:115311676-115311698 ATGGGAAAACAGGCTGAGAGTGG + Intronic
1089192436 11:116662702-116662724 TTGAAGAAACAGTCTCAGAGAGG - Intergenic
1089843026 11:121435215-121435237 ATGGAGAGAGAGATTGAGAGAGG - Intergenic
1089865995 11:121632318-121632340 ATGGATAAAATGTTAGAGAGTGG + Exonic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1090129329 11:124123327-124123349 ATGAAGAGACAGAGTGAGAGAGG - Intronic
1090135216 11:124190811-124190833 ATGGAGAATAAACTTGAGAGGGG - Intergenic
1090752473 11:129759623-129759645 CTGGAGTTACAGTTTAAGAGAGG - Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1092228609 12:6764789-6764811 TCAGAGAAACAGATTGAGAGAGG + Intronic
1092752631 12:11733027-11733049 ATGGAGAAACAGAGTCTGAGTGG - Intronic
1093511487 12:19934750-19934772 ATGGAGAGAGAGAGTGAGAGAGG + Intergenic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1093954566 12:25201509-25201531 AAGGAGAAGCAATTGGAGAGGGG + Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1098111038 12:67122130-67122152 ATGGATAATCAGTTTGGGAAAGG + Intergenic
1098789949 12:74808823-74808845 ATGGATAAAAAATTAGAGAGTGG + Intergenic
1099336765 12:81370561-81370583 ATGCAGGAACAGTTTGGGATTGG - Intronic
1100269366 12:93009458-93009480 ATTTAGAAACAGTTTGACAATGG - Intergenic
1100274046 12:93055223-93055245 AGGGAGAAAGAGATAGAGAGAGG + Intergenic
1100613210 12:96209185-96209207 ATGCAAAAAGAGTTTGAGAGAGG + Intronic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1100813220 12:98360896-98360918 ATGGAGAGAGAGATTAAGAGTGG + Intergenic
1100837894 12:98584577-98584599 ATGTGGAACGAGTTTGAGAGGGG - Intergenic
1101238813 12:102817450-102817472 ATGGAAAAAAAGTTTTAAAGAGG - Intergenic
1101314909 12:103620131-103620153 ATGAAAAGACAGTTTCAGAGAGG - Intronic
1101318086 12:103648157-103648179 ATGGAGACACAGTGAGGGAGTGG + Intronic
1101320773 12:103671104-103671126 GTGGAGAAACTTTTGGAGAGTGG - Intronic
1101582736 12:106058101-106058123 GTGAAGAAACAGATTGAAAGAGG - Intergenic
1101774883 12:107784566-107784588 ATGGGGAAATAGGTTCAGAGAGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101870727 12:108563115-108563137 CTGGGGAAACAGGTTCAGAGAGG - Intronic
1102010588 12:109616154-109616176 GTGGGGAAACAGGTTCAGAGAGG - Intergenic
1102710207 12:114919309-114919331 ATGGGGAAGCAGATTCAGAGAGG - Intergenic
1102762229 12:115398045-115398067 ATAGAAAAACAAGTTGAGAGGGG + Intergenic
1103247650 12:119471827-119471849 ATAGAGAAAGAGAGTGAGAGAGG - Intronic
1103273763 12:119694884-119694906 ATGGAGAAACAGGTTGTGAGAGG - Intronic
1103273966 12:119696473-119696495 ATGGAGAAACAGGTTATCAGAGG + Intronic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104956516 12:132469234-132469256 ATGGAGAAAAAGTAAGGGAGGGG + Intergenic
1106359968 13:29021962-29021984 AAGGAGAAAAAGCATGAGAGCGG + Intronic
1106361594 13:29036227-29036249 ATGGAGGAACAAACTGAGAGTGG - Intronic
1107358671 13:39595628-39595650 ATGGTGAAACAGTGGGAGTGGGG - Intronic
1107458006 13:40572898-40572920 AGGGAGCAGCAGTTTGTGAGGGG - Intronic
1108209404 13:48123173-48123195 ATAAAAAAAGAGTTTGAGAGAGG + Intergenic
1108259229 13:48640451-48640473 ATTGAGAGACAGCTAGAGAGGGG + Intergenic
1108664787 13:52618729-52618751 ATGGAAAATCAGTCTGAAAGGGG + Intergenic
1109672436 13:65626677-65626699 AAGGAGAAACAAGTAGAGAGTGG - Intergenic
1110179063 13:72593576-72593598 ATGGAGAAACAAGTTTTGAGAGG + Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1111423603 13:88050853-88050875 ACTTAGAAACAGTATGAGAGTGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112813256 13:103243595-103243617 TTGGGGAAACAGTTTCAGGGAGG - Intergenic
1113038875 13:106082779-106082801 ATTCAGATAAAGTTTGAGAGGGG + Intergenic
1113169503 13:107484435-107484457 AAGGAGAACCAGTTTGGCAGGGG + Intronic
1115297993 14:31852129-31852151 ATGGAGAGAAAGGTTCAGAGAGG - Intronic
1117047471 14:51827901-51827923 TTGGAGAGAGAGTCTGAGAGTGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119184303 14:72628657-72628679 ATGGAGACAGAGTTGGTGAGAGG + Intronic
1120315080 14:82881963-82881985 ATAGAGAAACTACTTGAGAGAGG - Intergenic
1120484350 14:85092273-85092295 ATGGAAAAAAAGTTGGAGAGAGG + Intergenic
1122849553 14:104520208-104520230 ATGGGGAACGTGTTTGAGAGTGG + Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1125884842 15:43220868-43220890 CAGAAGCAACAGTTTGAGAGAGG - Exonic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1127569648 15:60229592-60229614 TTGGAGAAATTGTTTCAGAGAGG - Intergenic
1128453924 15:67822428-67822450 AAGTAGAGACAGATTGAGAGAGG + Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1129813033 15:78526067-78526089 ATGGGGAAACAGATTCATAGAGG - Intronic
1130182140 15:81640918-81640940 AGGTAGAAACTGTTAGAGAGTGG - Intergenic
1131429312 15:92373904-92373926 GTGGACAAACATTTTGACAGAGG + Intergenic
1131578822 15:93620026-93620048 ACGGAGACAGAGATTGAGAGAGG + Intergenic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1136357988 16:29759088-29759110 AAGGAGAAAGAGAGTGAGAGAGG + Intergenic
1137013379 16:35346592-35346614 ATGGATAAACTGTGTAAGAGAGG + Intergenic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1137999267 16:53257409-53257431 ATGGAGAACAAGTTGGAAAGGGG + Intronic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138269882 16:55687949-55687971 ATGTAGAAACACAATGAGAGAGG + Intronic
1138858638 16:60727489-60727511 ATGGTGAAACAGAGAGAGAGTGG - Intergenic
1140316469 16:73902704-73902726 ATGCAGAAACTGTTTTACAGAGG + Intergenic
1140848936 16:78916287-78916309 ATGGAGACCCTGTTTCAGAGGGG + Intronic
1142607980 17:1092466-1092488 ATTGAGAAAGAGTCTGAGACTGG - Intronic
1142663209 17:1445680-1445702 ATGGAGAAACTGTTTAGGACAGG + Intronic
1143049704 17:4114666-4114688 ATGACGTAACAGTTTGAGGGAGG - Intronic
1143987744 17:10929779-10929801 ATGGAGAATAGGTTGGAGAGAGG + Intergenic
1144033797 17:11346418-11346440 ATCTAGAAACAATTTCAGAGAGG - Intronic
1144511885 17:15884125-15884147 CTGGAGGAACAGTTTCAGTGTGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1146185171 17:30719932-30719954 ATGGGGAAATAGGTTCAGAGAGG + Intergenic
1146757586 17:35447419-35447441 ATGCAGAAACATGTAGAGAGAGG + Intronic
1146794697 17:35773110-35773132 TTGGAGAAGCAGTTTGGGGGTGG - Intronic
1146807749 17:35878788-35878810 ATGGATAAACAGTGGCAGAGTGG + Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1149032269 17:52097736-52097758 AAGGAGACACAGTTTGATAGAGG + Intronic
1149341629 17:55692634-55692656 ATGATGAAACACGTTGAGAGAGG - Intergenic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1150070467 17:62146021-62146043 AAGGAGATAAAGTTAGAGAGAGG - Intergenic
1150300804 17:64045418-64045440 ATCGTGAAGCAGTTAGAGAGAGG - Exonic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1153581857 18:6582023-6582045 TTGGAGAAAGATGTTGAGAGTGG + Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154488751 18:14902634-14902656 ATGGAGAGTGAGGTTGAGAGTGG - Intergenic
1155393314 18:25360268-25360290 AAGAAGGAAGAGTTTGAGAGAGG - Intergenic
1155541405 18:26872384-26872406 ATGGAGAACCAGTTTGCAAGTGG + Intergenic
1156602665 18:38627966-38627988 ATGCAGAAACACTTTATGAGAGG - Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1158614025 18:58969362-58969384 ATGAAGAAAGGGTATGAGAGTGG - Intronic
1158889359 18:61858704-61858726 ATGGAGAAGAAGCTGGAGAGTGG + Intronic
1158980328 18:62754415-62754437 GCAGAGAAACAGTTTGGGAGGGG - Intronic
1160432318 18:78820115-78820137 ATGGAGAAACAGGGGGAGAGAGG + Intergenic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1162858963 19:13491186-13491208 ATGGAGAAACTTTATGAGACAGG - Intronic
1162973609 19:14195757-14195779 ATGGGGAAATAGGTTCAGAGAGG - Intronic
1163014566 19:14446399-14446421 AGGCAGAGACAGTCTGAGAGAGG - Intronic
1163207362 19:15813507-15813529 AGGGAGAAACAGAGAGAGAGAGG + Intergenic
1163818002 19:19479039-19479061 ATGGAGAAGAGGTTGGAGAGTGG + Intronic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164969400 19:32518326-32518348 ATTGAGAGCCAGTCTGAGAGGGG + Intergenic
1165028354 19:32978529-32978551 GGGGAGAAACAATTTGAAAGAGG + Intergenic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167029203 19:46945979-46946001 AGGGAGAAACAGTTTTACTGGGG + Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
926409278 2:12585235-12585257 ATGGAGAGAGGGTTGGAGAGTGG - Intergenic
926758225 2:16252919-16252941 GTGGGGAAACAGGCTGAGAGAGG + Intergenic
927189527 2:20507867-20507889 ATGGAGAAATGGGTTCAGAGAGG + Intergenic
928502062 2:31906784-31906806 ATAGAGATACAGTATAAGAGGGG - Intronic
928996861 2:37302222-37302244 ATGGGGGAACAGTTGGAAAGAGG - Intronic
929998480 2:46845186-46845208 ATGGAGCAGCAGTTGAAGAGAGG + Intronic
930378488 2:50597391-50597413 AAGAGGAAACAGCTTGAGAGGGG - Intronic
930414302 2:51070557-51070579 ATGGAGAAACAAGTACAGAGAGG + Intergenic
932263269 2:70344670-70344692 ATGGAGAAATAGTGGGAGAGAGG + Intergenic
932402389 2:71489877-71489899 ATGAGGAAACGGTTTCAGAGAGG - Intronic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
933414334 2:81966909-81966931 ACAGAGAAACATTTTGAGAAAGG + Intergenic
933437046 2:82261276-82261298 ATGGAGAATCATTTTGGGAGTGG - Intergenic
934867556 2:97826619-97826641 AAAGAGAAACAGTGAGAGAGGGG + Intronic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
936747475 2:115595406-115595428 ATGGTCAAACTGTTTGAGATTGG - Intronic
937190034 2:120086387-120086409 AGGGAGATACAGTTGGAAAGCGG + Intronic
937628069 2:124066411-124066433 ATTTAAAAACAGTTTCAGAGGGG - Intronic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937738777 2:125323181-125323203 ATGGAGAAATATTTTGCAAGTGG + Intergenic
938767733 2:134471789-134471811 ATGCATAAACAGTTGGAGAGAGG + Intronic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939595381 2:144116436-144116458 ATGGAAAAACATTTTTAGAAGGG - Intronic
939679508 2:145112887-145112909 ATGAAGAAAAAGTTTCAAAGAGG - Intergenic
940163151 2:150736273-150736295 AAGGAGAAGTAATTTGAGAGTGG + Intergenic
940214147 2:151287550-151287572 ATGGAGATTAAGTTTGGGAGAGG - Intronic
941141890 2:161793767-161793789 ATTTAGAAGCAGTTTGAAAGTGG - Intronic
941336842 2:164255990-164256012 ATGGAGAAACATTTTTAGTTTGG - Intergenic
941469676 2:165869039-165869061 ATGGAGATGCAGTTGCAGAGTGG + Intronic
943076357 2:183200358-183200380 ATGTAGAAACAGTAGGACAGTGG + Intergenic
943458183 2:188134692-188134714 AAGGAGAAAGAGACTGAGAGAGG + Intergenic
944276762 2:197847775-197847797 ATAGGGAGACAGCTTGAGAGCGG - Intronic
945571667 2:211475322-211475344 AAGGAGAATGAGTTTCAGAGAGG - Intronic
945794707 2:214347943-214347965 ATGGAGAATCATTCTTAGAGGGG + Intronic
945946566 2:216001087-216001109 ATGCAGAGACAGCTAGAGAGAGG - Intronic
945978529 2:216289538-216289560 ATGGAGAAACAACTGGAGACTGG - Intronic
946669546 2:222088205-222088227 ATGCACACACAGATTGAGAGAGG - Intergenic
947936355 2:234008014-234008036 AGAGAAAAACAGATTGAGAGAGG - Intronic
948791181 2:240377664-240377686 GTGGAGAAACAGATTAATAGTGG + Intergenic
1168957742 20:1846418-1846440 ATGGAGAACAAGGTGGAGAGTGG + Intergenic
1169459889 20:5785350-5785372 ATGAGGAAACAGTTTTAGAGAGG + Intronic
1169933077 20:10854715-10854737 CTGGAGAAAAAGTGTGAGACAGG - Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170793813 20:19529458-19529480 ATGGAGACCCAGGTTGAAAGTGG - Intronic
1170793904 20:19530174-19530196 ATGGAGACACAGCATGAAAGGGG + Intronic
1173149108 20:40550744-40550766 ATGAGGAAACAGTTTCAAAGAGG + Intergenic
1173193904 20:40897809-40897831 ATGGAGAATCGGTTGGACAGAGG + Intergenic
1173286154 20:41673044-41673066 AAGGACAAAGAGTTTTAGAGAGG + Intergenic
1173827145 20:46055367-46055389 ATGTAGAAACCCTTAGAGAGTGG + Intronic
1174109281 20:48186893-48186915 TTGGAGTCACAGTTTGAAAGAGG - Intergenic
1174505947 20:51017709-51017731 ATGGAGATTCTGTGTGAGAGAGG + Intronic
1174563651 20:51448963-51448985 GTGGAAAAACAGTAGGAGAGGGG - Intronic
1175360808 20:58410934-58410956 ATGCAGAAGCATTTTGTGAGTGG - Intronic
1177793511 21:25747072-25747094 ATGTAGAAACAGATTTAAAGAGG + Intronic
1178138535 21:29655742-29655764 ATGAAGAAACAGTGTGAAATTGG - Intronic
1178146532 21:29746704-29746726 ATTGAGCAACAGGTTTAGAGAGG + Intronic
1179058194 21:37955215-37955237 TTAGAGTAACAGTTTGATAGAGG + Intronic
1179805835 21:43836300-43836322 ATGGAGAAACAGATTTGGAGGGG - Intergenic
1181436900 22:22916432-22916454 ATGGACAAACACCTTGAGAGAGG - Intergenic
1182003613 22:26941027-26941049 AAGGAGAAGCAGGTTGAAAGAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182447462 22:30397906-30397928 AGGGGGCAACAGTTTGAGGGCGG + Intronic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1184173892 22:42775120-42775142 ATGGAGAAACAACTGGAGACTGG + Intergenic
1184178884 22:42806015-42806037 AAAGAGAAACAGCTCGAGAGAGG - Intronic
1184372694 22:44092713-44092735 ATGGAGAAATAGGTGCAGAGAGG + Intronic
1184485190 22:44774060-44774082 ATGGAGACACGGGTTGAGACAGG + Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1185091752 22:48779469-48779491 AAGGAGAAACAGGTTTCGAGAGG + Intronic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950716254 3:14849751-14849773 ATGGAGAAACAGGTGCACAGAGG - Intronic
951810143 3:26689609-26689631 ATGGAGAAAGAGCAGGAGAGAGG - Intronic
952123276 3:30270072-30270094 ATGGAGAAACTTTTGGAGAGCGG + Intergenic
952225383 3:31370137-31370159 ATGGAGAAACAGATTTTCAGAGG - Intergenic
952245814 3:31591089-31591111 AAGAAGAAACAGTTTCTGAGAGG - Intronic
952300505 3:32100644-32100666 ATGGAGAAGCAGCTCCAGAGAGG + Intergenic
953167487 3:40478119-40478141 ATGTAAAAACAGTATGCGAGGGG + Intronic
953211875 3:40883042-40883064 ATGGAGGAACAGCTGGTGAGTGG + Intergenic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955231616 3:57104359-57104381 CTGGAGAAACATTTTGAAGGAGG + Exonic
955302223 3:57791552-57791574 CTTGAAAAACAGTTTGAGAAGGG + Intronic
955990228 3:64619040-64619062 ATGGAGCACCAATTTGAGGGTGG - Intronic
956312101 3:67892653-67892675 ATGGAGGAATAGATTGAGTGAGG + Intergenic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
956955968 3:74340408-74340430 ATGGAAAAAAAGAGTGAGAGAGG + Intronic
957525768 3:81376815-81376837 ATATAGTAACAGTTTGTGAGTGG - Intergenic
958100631 3:89004834-89004856 ATGGAGAAATATTTTGTGAAAGG - Intergenic
958881896 3:99681504-99681526 AGGTAGAAAGAGTTTGAGTGGGG + Intronic
959459328 3:106605012-106605034 TTGGAGAGACAGTTTGTCAGAGG + Intergenic
959749652 3:109818648-109818670 ATGGAGGAACTGATTGTGAGTGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959822432 3:110752464-110752486 GTGGTAAAACAGGTTGAGAGAGG - Intergenic
959860567 3:111210656-111210678 AAGGGGAAACAGTTTTAGATTGG + Intronic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962299120 3:134221988-134222010 ATGGAGAAACGGTGTAAGAAAGG - Intronic
963161216 3:142152214-142152236 ATGGGAAAACAGTTGGAGATGGG - Intergenic
963520965 3:146359541-146359563 ATGGAGAGGCAGTGTGAGACTGG + Intergenic
964246782 3:154663095-154663117 AAGGAGAAACAGTAAGAAAGAGG - Intergenic
964796968 3:160509111-160509133 AAGGAAAAACAGTTTTAAAGAGG - Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965145664 3:164899249-164899271 ATGGAGAGATAATATGAGAGGGG + Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966677115 3:182601581-182601603 ATGGAGAGACAATTTGCGCGTGG - Intergenic
967236254 3:187386287-187386309 ATGGAGAAACTGTTGGGGAGTGG - Intergenic
967391674 3:188962161-188962183 AGGGGGAAAAAGTTAGAGAGGGG + Intronic
967523723 3:190467660-190467682 ATGGAAAAGATGTTTGAGAGGGG - Intergenic
968001398 3:195209284-195209306 ATGACAAGACAGTTTGAGAGCGG - Intronic
968732623 4:2276833-2276855 ATGGGGAAACAGTTTCAGTTTGG + Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970004594 4:11398462-11398484 ATGGAGAAGCAGTTAGTGACTGG - Exonic
972361382 4:38328629-38328651 ATGGAGAAAAAGAGGGAGAGAGG - Intergenic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
974471632 4:62326171-62326193 ATGGAGAAACAGCTGGCCAGTGG - Intergenic
975624325 4:76328725-76328747 TTCAAGGAACAGTTTGAGAGTGG + Intronic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
979600379 4:122580991-122581013 AAAGAGAAAGAGATTGAGAGAGG + Intergenic
979662114 4:123269071-123269093 ATGGAGAAACAGTTCTGGATTGG - Intronic
980147034 4:128999600-128999622 CTGAAGAAACTGTTTTAGAGGGG - Intronic
981413572 4:144461558-144461580 ATTGAGACACATTTTGAGACTGG - Intergenic
981649433 4:147039201-147039223 TGGGAGAAACAGTTGGATAGGGG - Intergenic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
983773717 4:171580700-171580722 ATGGACAAACAGATTAAGATTGG - Intergenic
984160870 4:176250591-176250613 ATAAAGAAACAGGTCGAGAGAGG + Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
986803317 5:11283999-11284021 ATTGAGAAACAGTTTTATGGTGG - Intronic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
986851215 5:11816387-11816409 GTGCAGCAACAGTTTGAGAGAGG + Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
988501032 5:31783967-31783989 ATGAGGGAACAGATTGAGAGGGG - Intronic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
990551925 5:56890133-56890155 AAGGAGAATTAGTTTGAAAGAGG - Intronic
990603140 5:57381450-57381472 ATGGACAAACTGTTTGGGAGGGG + Intergenic
992309295 5:75478786-75478808 ATGGAGAAATAGTATCAGATAGG - Intronic
994144076 5:96372992-96373014 TTGGAGAATCAGTTCAAGAGAGG - Intergenic
995063543 5:107837000-107837022 ATGGAGACAGAGTAGGAGAGAGG - Intergenic
996324923 5:122262213-122262235 ATGGAAAAACAGTTATACAGTGG + Intergenic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997890038 5:137667968-137667990 ATGAGGAAACAGCCTGAGAGAGG + Intronic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
998769770 5:145529125-145529147 ATTGTGAAACAGTTTCAGAATGG + Intronic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999921392 5:156325482-156325504 ATGAGGAAACAGATCGAGAGAGG + Intronic
999997308 5:157104567-157104589 ATGAGAAAACAGTGTGAGAGTGG - Intronic
1000027039 5:157368366-157368388 ATGGAGTGACGGTCTGAGAGGGG - Intronic
1000592726 5:163177935-163177957 TTGGAGAAGCAGTTTGTGGGAGG + Intergenic
1000669694 5:164045712-164045734 GTGGATAAACAGTTTAACAGTGG - Intergenic
1000930879 5:167249811-167249833 ATAGAGAAACACATTTAGAGAGG - Intergenic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002327700 5:178420570-178420592 AAGGAGAAAGAGTGGGAGAGGGG - Intronic
1002702145 5:181131622-181131644 CTGGAGAAAAAGTGTGAGTGTGG - Intergenic
1003311069 6:4970438-4970460 GAGGATAAACAGTTTGAGAGAGG + Intergenic
1004293493 6:14389434-14389456 ATAGAGAAAGAGTTTAAGACAGG + Intergenic
1004709798 6:18158567-18158589 ATGGATAAAGAATTTGAAAGTGG - Intronic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1007207794 6:40166668-40166690 GTGAGGAAACAGTTTCAGAGAGG - Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1008359812 6:50602694-50602716 ATGGCCAAATAGTTTGATAGAGG - Intergenic
1008831418 6:55767472-55767494 ATGAGGAAACAGTCAGAGAGAGG + Intronic
1008911987 6:56744347-56744369 ATGGAGAAAAACTTTGAAAAAGG + Intronic
1010799692 6:80161026-80161048 ATTGAGGAACTGTTTCAGAGTGG + Intronic
1011454339 6:87531120-87531142 ATTTAGAAACATTTTGAGAAGGG - Intronic
1011522196 6:88220730-88220752 ATTGAGAATCACTTTGAAAGGGG - Intergenic
1011953258 6:92994901-92994923 AGGGAAAATCAGTTTCAGAGAGG + Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012606061 6:101158774-101158796 ATGGAGAATGATTTTGAGACAGG + Intergenic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013632965 6:112002678-112002700 ATGGAGAAGAAGCTGGAGAGAGG + Intergenic
1014191415 6:118500863-118500885 TTGGATAAACAGCTTGTGAGAGG + Intronic
1016522460 6:144962194-144962216 ATAGGGAAACAGGTTGAGATAGG + Intergenic
1016761433 6:147741720-147741742 ATGGAAAAACAGGTTGAGTGTGG + Intergenic
1017537046 6:155358609-155358631 ATGTAGTGAGAGTTTGAGAGAGG + Intergenic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1018201184 6:161397093-161397115 AGGGTGAAACAGTTTAATAGAGG - Intronic
1018681715 6:166270689-166270711 ATGGAGAAACTGTGTGGGTGAGG - Intergenic
1019013806 6:168864935-168864957 ATGGAGAAAGAGACAGAGAGAGG + Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1021806973 7:24367319-24367341 AAGGAGAGACATTTGGAGAGCGG + Intergenic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024715371 7:52074106-52074128 ATGGAGAAAGAGGTGTAGAGGGG + Intergenic
1027574369 7:79913756-79913778 ATGGAGAAAGAGAGGGAGAGAGG + Intergenic
1027615231 7:80414937-80414959 ATGGAGAAAAAGTAAAAGAGAGG + Intronic
1028744366 7:94310487-94310509 ATAGAGAAACAGAGAGAGAGAGG - Intergenic
1029361226 7:100089734-100089756 AAGGAGGAGCAGTGTGAGAGTGG + Exonic
1030272404 7:107684752-107684774 CTGGAGAAACTCTTTAAGAGAGG + Intronic
1031449523 7:121897303-121897325 GTGGAGATACAGTTTGAAATAGG + Intronic
1031557150 7:123191493-123191515 ATGGAGAAAGAGCTTGGGAAGGG + Intronic
1031837404 7:126694941-126694963 ATGGAGAAACAGAATGTAAGTGG + Intronic
1032482351 7:132257025-132257047 ATGAAGACACAGGTTGGGAGGGG + Intronic
1032628502 7:133620809-133620831 CTGGAGAATCAGTTAAAGAGTGG + Intronic
1033895852 7:146069003-146069025 ATGCAGAATAAGTTTGAGGGAGG + Intergenic
1033966891 7:146986148-146986170 ATGGAGAAAGGGTGGGAGAGGGG - Intronic
1034361984 7:150507702-150507724 ACAGAGAAACATTTTGTGAGAGG + Intergenic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1035091250 7:156313440-156313462 AAGCAGAAACAGTTTGAAAAGGG - Intergenic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1038028413 8:23613889-23613911 ATTCAGAAAAATTTTGAGAGAGG + Intergenic
1038058538 8:23885994-23886016 ATGGAGAAAGAATTGGAGTGGGG + Intergenic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1039333947 8:36569404-36569426 AAGGAGAAACAGTTTTATTGTGG - Intergenic
1039599826 8:38826625-38826647 ATGGAAATACAGATTTAGAGAGG + Intronic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040598507 8:48862527-48862549 GTAGAGAAACAGCTTGGGAGAGG + Intergenic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042960731 8:74301216-74301238 ATGGAGAAAGAATTTAAGTGGGG - Intronic
1043264208 8:78242562-78242584 ATGCAGATACAGCCTGAGAGGGG - Intergenic
1043293100 8:78628426-78628448 ATGCAGAAACATTTTTATAGTGG - Intergenic
1044399473 8:91753829-91753851 GAGGAGAAACTATTTGAGAGAGG + Intergenic
1044904475 8:96986160-96986182 ATGGAGATGCAGTTTGTAAGTGG + Intronic
1045845343 8:106628411-106628433 ATGAAGAAACAGATTTTGAGAGG + Intronic
1046069602 8:109234371-109234393 ATGGGGAAGCAGTTTGAAAGAGG - Intergenic
1047540545 8:125761394-125761416 TTGGAGACAGAGTTTGATAGAGG + Intergenic
1047766482 8:127994128-127994150 AAGGAGAGACAGTTGGAGAGGGG - Intergenic
1047820976 8:128520306-128520328 ATGAAGAAAGAGTTTTAGAGAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047997561 8:130351106-130351128 AGAGAGAAAGAGTTTGGGAGAGG - Intronic
1050013275 9:1207534-1207556 AAGGAGAAAGAGATGGAGAGAGG + Intergenic
1051610152 9:18953785-18953807 ATGGATAAACAGTGTGTAAGAGG + Intronic
1051782605 9:20706648-20706670 ATGAAGAAACAATGTCAGAGAGG - Intronic
1052830181 9:33208808-33208830 ATGCAGAAACAGTCTTAAAGAGG - Intergenic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053504981 9:38634879-38634901 TTGGAGCATCAGTTTTAGAGAGG + Intergenic
1054800686 9:69345420-69345442 AAAGAGAAACAGTCTCAGAGAGG - Intronic
1054836798 9:69683856-69683878 CTGGAGAAACCTTTTGAGTGTGG + Intergenic
1055280739 9:74671205-74671227 AGGGAGAAACAGATGAAGAGAGG + Intronic
1056488390 9:87082007-87082029 ATGGAAAAAGAGTTTTAGGGAGG - Intergenic
1057471032 9:95356842-95356864 ATTGAGAAACAGTGTAACAGTGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058148940 9:101443046-101443068 ATGGAGAAATCTTTTGAGGGTGG - Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060458127 9:123820047-123820069 AGGGAAAAACATATTGAGAGGGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060593941 9:124836845-124836867 CTAGGGAAACAGTTTCAGAGAGG + Intergenic
1060717988 9:125952039-125952061 AGGGAGAAACTGTTTGTTAGAGG + Intronic
1060783406 9:126430416-126430438 ATGGAGAGGCAGCTTGGGAGTGG - Intronic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061379246 9:130244182-130244204 ATGAGGAAACAGCTTCAGAGAGG + Intergenic
1185948706 X:4406435-4406457 ATGGAGAGAGAGAATGAGAGAGG + Intergenic
1188007397 X:25025042-25025064 ATGGTGAAATAGTATCAGAGGGG + Intergenic
1188323192 X:28765944-28765966 ATGCAGAAACACTCTCAGAGGGG - Intronic
1189218659 X:39350637-39350659 ATGGGGAAAGAGTGAGAGAGGGG + Intergenic
1189258194 X:39656692-39656714 TTGGAGAAACAGATTAAAAGAGG + Intergenic
1189576248 X:42356823-42356845 AGTGAGAAACATTTAGAGAGGGG + Intergenic
1189936257 X:46071981-46072003 AAGGAGTAACATTTTCAGAGGGG - Intergenic
1189998447 X:46661730-46661752 TTGGAGCATCAGTTTTAGAGGGG - Intronic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1190713915 X:53088359-53088381 ATGGAGAAAGAACTTGGGAGAGG - Exonic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1195098966 X:101535200-101535222 ATGATAAAACATTTTGAGAGGGG - Intergenic
1195388344 X:104334824-104334846 AAGGAGAAACAGTCTGCAAGTGG + Intergenic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1196023016 X:111010099-111010121 AGGAAGAAACAGTTTCAGATGGG - Intronic
1196032889 X:111110276-111110298 ATGAAGAAATAGCTTCAGAGGGG + Intronic
1196571415 X:117269506-117269528 ATGGAGAATGAGTTTGACAAAGG + Intergenic
1196642165 X:118074727-118074749 ATAGTGAAACAGTTTGGGGGTGG - Intronic
1196687356 X:118522970-118522992 ATGGGAAAACAGATTAAGAGAGG - Intronic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1198107133 X:133472709-133472731 ATAAAGAAACAGGGTGAGAGTGG + Intergenic
1198281384 X:135146221-135146243 AGCGAGAAACAGTCTGATAGCGG - Intergenic
1198289575 X:135226295-135226317 AGCGAGAAACAGTCTGATAGCGG + Intergenic
1198551114 X:137745847-137745869 AGGCAGAAACAGGCTGAGAGAGG + Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1201296858 Y:12471174-12471196 ATGGAGTAACGGTTCTAGAGAGG + Intergenic