ID: 920065483

View in Genome Browser
Species Human (GRCh38)
Location 1:203266657-203266679
Sequence CGGGGTGGCAGCTGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2775
Summary {0: 1, 1: 3, 2: 80, 3: 584, 4: 2107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920065474_920065483 12 Left 920065474 1:203266622-203266644 CCATTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG 0: 1
1: 3
2: 80
3: 584
4: 2107
920065470_920065483 28 Left 920065470 1:203266606-203266628 CCATCGTCATCATGGCCCATTCT 0: 91
1: 532
2: 969
3: 791
4: 250
Right 920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG 0: 1
1: 3
2: 80
3: 584
4: 2107
920065472_920065483 13 Left 920065472 1:203266621-203266643 CCCATTCTCAATGAGCTGTTGGG 0: 131
1: 1458
2: 426
3: 118
4: 231
Right 920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG 0: 1
1: 3
2: 80
3: 584
4: 2107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920065483 Original CRISPR CGGGGTGGCAGCTGAGCAGA GGG Intronic
Too many off-targets to display for this crispr