ID: 920069055

View in Genome Browser
Species Human (GRCh38)
Location 1:203289533-203289555
Sequence CAGCACCCAGAGCTTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920069048_920069055 17 Left 920069048 1:203289493-203289515 CCACTAGCTATTTTTCATGCCTC No data
Right 920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG No data
920069047_920069055 27 Left 920069047 1:203289483-203289505 CCAAGGAGGGCCACTAGCTATTT No data
Right 920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG No data
920069049_920069055 -2 Left 920069049 1:203289512-203289534 CCTCAAACTCCCACTCTATCACA No data
Right 920069055 1:203289533-203289555 CAGCACCCAGAGCTTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920069055 Original CRISPR CAGCACCCAGAGCTTGGGGA TGG Intergenic
No off target data available for this crispr