ID: 920071720

View in Genome Browser
Species Human (GRCh38)
Location 1:203307124-203307146
Sequence TTTCCCGAAAAGCCGTCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920071714_920071720 16 Left 920071714 1:203307085-203307107 CCTGGTCCTGTCTCCACAGAGCA 0: 1
1: 1
2: 4
3: 22
4: 288
Right 920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 50
920071713_920071720 17 Left 920071713 1:203307084-203307106 CCCTGGTCCTGTCTCCACAGAGC 0: 1
1: 0
2: 3
3: 35
4: 360
Right 920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 50
920071716_920071720 3 Left 920071716 1:203307098-203307120 CCACAGAGCACTACAAACACCAC 0: 1
1: 0
2: 2
3: 22
4: 317
Right 920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 50
920071715_920071720 10 Left 920071715 1:203307091-203307113 CCTGTCTCCACAGAGCACTACAA 0: 1
1: 0
2: 1
3: 25
4: 399
Right 920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 50
920071711_920071720 30 Left 920071711 1:203307071-203307093 CCAGGGCATCTGCCCCTGGTCCT 0: 1
1: 0
2: 1
3: 40
4: 411
Right 920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 50
920071712_920071720 18 Left 920071712 1:203307083-203307105 CCCCTGGTCCTGTCTCCACAGAG 0: 1
1: 0
2: 3
3: 26
4: 327
Right 920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920071720 Original CRISPR TTTCCCGAAAAGCCGTCCAA GGG Exonic
905303916 1:37004687-37004709 TGTCCTCAAAAGCTGTCCAATGG + Intronic
916015065 1:160742402-160742424 TTTGCTGAGAAGCCATCCAAAGG + Intronic
920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG + Exonic
921740075 1:218674302-218674324 TTTTCCCAAAGGCCTTCCAAGGG - Intergenic
1067909520 10:50332063-50332085 TGTCCCTTAAAGCCCTCCAATGG + Intronic
1079292227 11:19198629-19198651 TTTGCAGAAAAGCTGCCCAATGG + Intronic
1100186275 12:92144405-92144427 TTCCCAGAAAAGCCATGCAAGGG - Exonic
1104843084 12:131833921-131833943 ATTCCCTAAAAACCGTCAAAGGG + Intronic
1112311437 13:98320751-98320773 TTTTCCAAAAAGCCTCCCAAAGG + Intronic
1118786008 14:69045803-69045825 TTTCTCTAAAAGTCATCCAAAGG + Intergenic
1126016371 15:44355244-44355266 TTCCCAGAAAAGCCATCCATAGG - Intronic
1137696376 16:50464818-50464840 TTTCCCGGAAAGTGTTCCAAGGG + Intergenic
1146240023 17:31212265-31212287 TTCCCCTAAAAACCTTCCAATGG - Intronic
1148899254 17:50863863-50863885 TATCCTGAAAAGCCATACAAAGG - Exonic
1159982852 18:74807119-74807141 TTGCCCGAAAAGCCTTAAAAAGG - Intronic
1162672014 19:12265821-12265843 TTTCCCTAAAAGTCGTCGAGAGG + Intronic
929917379 2:46147476-46147498 TTTCATGAAAAGCAGTCCATTGG + Intronic
930111802 2:47685118-47685140 TGTCCAGAAAAGCTGTCCACAGG - Intergenic
931583032 2:63797409-63797431 TGTCCAGAAATGCCGTCCAGGGG - Intronic
938426876 2:131200206-131200228 TTCCCCTAAAAACCTTCCAATGG + Intronic
939709499 2:145499301-145499323 TTTCCTGAAAAGCCTTCTATTGG - Intergenic
943901186 2:193439360-193439382 TTGCCCCAAAAGATGTCCAAAGG + Intergenic
947803797 2:232950613-232950635 TTTCCAGAAAAGGCTACCAAAGG + Intronic
948728063 2:239946758-239946780 TTTCCCCAAAATCTGACCAAAGG - Intronic
1170059333 20:12243118-12243140 TTTCCCTCACAGCCCTCCAAAGG + Intergenic
1171821245 20:29843449-29843471 TTTCCAGAATAGGCGTCAAAGGG - Intergenic
1171986674 20:31665701-31665723 TTTCCACAAAATCTGTCCAAAGG - Exonic
955200574 3:56848447-56848469 TGTCCCAAAAAGCCCTCTAAGGG - Intronic
956746381 3:72314246-72314268 TTTCCAGAAAAGCCCCCAAATGG - Intergenic
960417200 3:117399026-117399048 TTTCCCAAAAAGCCCTCGAAGGG - Intergenic
961163386 3:124748389-124748411 TTTCCCCATAACCCTTCCAAAGG + Intergenic
961805325 3:129485236-129485258 TTTCCCTAAAAGTCTTTCAAAGG - Intronic
962631701 3:137282905-137282927 TTTCCAGAAAAGCCACCAAAGGG - Intergenic
968120302 3:196121283-196121305 TTTCCCCAAAAGCCACCCAAAGG - Intergenic
971155258 4:24074906-24074928 TTTGCCGAAAAGCAGAACAAAGG + Intergenic
972438222 4:39056160-39056182 TTGCCCGAGCAGCCGTGCAATGG + Intronic
979845975 4:125512538-125512560 TTTTCTTAAAAGCCGACCAAAGG - Intergenic
980747141 4:137033093-137033115 TTTCCCGACAATCTCTCCAATGG - Intergenic
988991317 5:36673590-36673612 TCTCCAGAAAAGCCTCCCAAAGG - Intronic
993532025 5:89036807-89036829 TTCCCCTGAAAGCCATCCAAGGG - Intergenic
995279246 5:110314763-110314785 TTTCACAAAAAGACATCCAATGG + Intronic
1003088691 6:3082632-3082654 TTTCCCCAAATGGCGTCCAGAGG - Intronic
1004744948 6:18500774-18500796 TTTCCGCAGAAGTCGTCCAAGGG - Intergenic
1006811740 6:36824580-36824602 TCTCCAGAAAAGCAGTTCAAGGG - Intronic
1022707463 7:32817620-32817642 TTTCCCAAAAGGCAGTCCACTGG - Intergenic
1023556536 7:41429443-41429465 TTTCTAGAAAAGCCTCCCAAAGG + Intergenic
1032238239 7:130142148-130142170 TTTCCAGAAAACCCTTCCAGGGG + Intergenic
1042356569 8:67834949-67834971 CTTCCCCAACAGCCCTCCAAAGG - Intergenic
1045137132 8:99233364-99233386 TTTCCCGAAGATCCGTCCCTGGG + Intronic
1056279644 9:85028789-85028811 TCTCCCGCAGAGCCTTCCAAGGG - Intergenic
1059023682 9:110602354-110602376 TTTCCCTAAAAGCTGCTCAAGGG - Intergenic
1197198387 X:123726608-123726630 TTTTGCAAAAAGCCTTCCAATGG + Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic