ID: 920074050

View in Genome Browser
Species Human (GRCh38)
Location 1:203324226-203324248
Sequence CACCCACATCTCCCAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920074050_920074054 -7 Left 920074050 1:203324226-203324248 CCACTTCCTGGGAGATGTGGGTG No data
Right 920074054 1:203324242-203324264 GTGGGTGTGGGAAACTTGAGAGG No data
920074050_920074056 25 Left 920074050 1:203324226-203324248 CCACTTCCTGGGAGATGTGGGTG No data
Right 920074056 1:203324274-203324296 CGCAGCTTCTTCTGTTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920074050 Original CRISPR CACCCACATCTCCCAGGAAG TGG (reversed) Intergenic
No off target data available for this crispr