ID: 920074054

View in Genome Browser
Species Human (GRCh38)
Location 1:203324242-203324264
Sequence GTGGGTGTGGGAAACTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920074046_920074054 -1 Left 920074046 1:203324220-203324242 CCCACTCCACTTCCTGGGAGATG No data
Right 920074054 1:203324242-203324264 GTGGGTGTGGGAAACTTGAGAGG No data
920074047_920074054 -2 Left 920074047 1:203324221-203324243 CCACTCCACTTCCTGGGAGATGT No data
Right 920074054 1:203324242-203324264 GTGGGTGTGGGAAACTTGAGAGG No data
920074050_920074054 -7 Left 920074050 1:203324226-203324248 CCACTTCCTGGGAGATGTGGGTG No data
Right 920074054 1:203324242-203324264 GTGGGTGTGGGAAACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920074054 Original CRISPR GTGGGTGTGGGAAACTTGAG AGG Intergenic
No off target data available for this crispr