ID: 920074056

View in Genome Browser
Species Human (GRCh38)
Location 1:203324274-203324296
Sequence CGCAGCTTCTTCTGTTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920074047_920074056 30 Left 920074047 1:203324221-203324243 CCACTCCACTTCCTGGGAGATGT No data
Right 920074056 1:203324274-203324296 CGCAGCTTCTTCTGTTTACCTGG No data
920074053_920074056 19 Left 920074053 1:203324232-203324254 CCTGGGAGATGTGGGTGTGGGAA No data
Right 920074056 1:203324274-203324296 CGCAGCTTCTTCTGTTTACCTGG No data
920074050_920074056 25 Left 920074050 1:203324226-203324248 CCACTTCCTGGGAGATGTGGGTG No data
Right 920074056 1:203324274-203324296 CGCAGCTTCTTCTGTTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920074056 Original CRISPR CGCAGCTTCTTCTGTTTACC TGG Intergenic
No off target data available for this crispr