ID: 920076578

View in Genome Browser
Species Human (GRCh38)
Location 1:203341679-203341701
Sequence GGCTTTCCAGGGGTGAGGTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920076568_920076578 27 Left 920076568 1:203341629-203341651 CCACATCAGGTCATGAATATTAT 0: 1
1: 0
2: 0
3: 18
4: 226
Right 920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG 0: 1
1: 0
2: 0
3: 26
4: 310
920076567_920076578 28 Left 920076567 1:203341628-203341650 CCCACATCAGGTCATGAATATTA 0: 1
1: 0
2: 1
3: 17
4: 176
Right 920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG 0: 1
1: 0
2: 0
3: 26
4: 310
920076572_920076578 -10 Left 920076572 1:203341666-203341688 CCTCCAATCTGGTGGCTTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 150
Right 920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG 0: 1
1: 0
2: 0
3: 26
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920076578 Original CRISPR GGCTTTCCAGGGGTGAGGTT AGG Exonic
900342927 1:2197230-2197252 GGCTTTCCAGGGGTGGGGGCTGG - Intronic
900528434 1:3140711-3140733 GGCCTCCCAGGTGTGAGGGTGGG + Intronic
900538920 1:3193154-3193176 GGCTTACCAGGGGGCAGCTTTGG + Intronic
902536908 1:17124445-17124467 GGCTTTCCATGGATGGGGGTGGG + Intergenic
902749690 1:18499160-18499182 GGGTTTTCAGGCCTGAGGTTGGG - Intergenic
902805103 1:18856087-18856109 GGCTTTTCCTGGGTGACGTTAGG - Intronic
903777954 1:25805264-25805286 GGCTTCCTAGGGGTGAGTTGGGG + Exonic
904328322 1:29741932-29741954 GGCTTTGGAGGGGTGGGGTGGGG - Intergenic
905160743 1:36031699-36031721 TGCTTTCCAGGGGTTACGTGAGG - Intronic
906822509 1:48944228-48944250 GTCTTCCCAGGGGTTAGGTGGGG + Intronic
907048293 1:51313362-51313384 GGCGGCCCAGGGGTGGGGTTTGG - Intronic
907108500 1:51905621-51905643 GGCTTTCCAGGGATGGAGTCAGG - Intergenic
908896729 1:68909659-68909681 GTGTTTCCAGGGTTGAGGGTGGG - Intergenic
909086492 1:71174570-71174592 GGGTTTCCAGGGTTGAGGGTGGG + Intergenic
910549112 1:88455979-88456001 GGCTGCTCTGGGGTGAGGTTGGG - Intergenic
911335483 1:96575454-96575476 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
915519962 1:156436312-156436334 GGATTTCCCGGGGTCGGGTTCGG - Intergenic
916705216 1:167342157-167342179 GGGTTTCCAGGCTTGAGGGTGGG + Intronic
916918852 1:169440091-169440113 GGGTTTCCAGGCTTGAGGGTGGG + Intronic
917519546 1:175736550-175736572 GGCTTTTCGGGGGTGAGGGAGGG + Intronic
918312983 1:183299693-183299715 TGCTTTCCAGGGGTTAGGGATGG + Intronic
919011007 1:191963194-191963216 GGCTTTCCTGGAGTGTGGCTTGG - Intergenic
919656266 1:200200412-200200434 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
919788528 1:201275485-201275507 GGCTATACAGGGCTGGGGTTGGG + Intergenic
920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG + Exonic
920116788 1:203627148-203627170 GGGTTTCCATGGATGAGGGTAGG - Exonic
920461062 1:206140889-206140911 GGATTTCCAGGCTTGAGGGTGGG - Intergenic
922033359 1:221825449-221825471 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
922472290 1:225883770-225883792 GGCTGTCCAGGAGTGGGGTGGGG + Intergenic
922475734 1:225905897-225905919 GGCTGTCCAGGGGTGGGGTGGGG - Intronic
922691608 1:227696637-227696659 GGCATTCCAGTGTTGTGGTTGGG - Intergenic
923137709 1:231133065-231133087 CGCTTTCCAGGGGCGAGGGGTGG + Intergenic
923416066 1:233761683-233761705 GGCTTCCCAGGGGATAGGGTTGG - Intergenic
924470207 1:244336663-244336685 GGCCTCCCAGGGCTGAGGTGTGG - Intergenic
924587353 1:245371598-245371620 GGCTTTCCAGCAGTGAGCCTGGG + Intronic
1064766908 10:18684532-18684554 GGGTTTCCCAGGGTGAGATTAGG + Intergenic
1065854089 10:29815688-29815710 GACTTTGCAGGGGAGAGGTGAGG + Intergenic
1067495826 10:46759223-46759245 GGCTTTCCTGGGGTGATGGGAGG - Intergenic
1067598829 10:47581167-47581189 GGCTTTCCTGGGGTGATGGGAGG + Intergenic
1067948488 10:50707745-50707767 GGCTTTCCTGGGGTGATGGGAGG + Intergenic
1068167723 10:53353042-53353064 GCCTGTCGAGGGGTGAGGTTGGG + Intergenic
1069244616 10:66188378-66188400 TGGTTACCAGGGGTGAGGGTGGG - Intronic
1069373254 10:67768856-67768878 GGCATTCTAGGGGTGAAGTTTGG - Intergenic
1069902688 10:71715093-71715115 CGCTTTCCCTGGGTGAGGTGTGG + Exonic
1069959284 10:72070200-72070222 GGGTTTCCAGGACTGAGGTGGGG - Intronic
1070760357 10:79020471-79020493 GGGTGTCTAGGGGAGAGGTTTGG - Intergenic
1070883808 10:79872742-79872764 GGCTTTCCTGGGGTGATGGGAGG + Intergenic
1071011432 10:80944829-80944851 GGGTATCCAGGTGTGAGGGTGGG + Intergenic
1071650365 10:87389044-87389066 GGCTTTCCTGGGGTGATGGGAGG + Intergenic
1072169149 10:92843501-92843523 GGGTTCCCAGGGGTGAGGAGGGG + Intronic
1073618863 10:105026262-105026284 GGCTGTCCAGGGGAGAGGGCTGG - Intronic
1074125579 10:110526231-110526253 GGCTCCCCAGGGGTGGGATTGGG - Intergenic
1075735616 10:124662938-124662960 GGCATTCCAGGCTTGAGGTGCGG - Intronic
1077026145 11:440958-440980 GGCTGGCCAGGGGTTGGGTTGGG - Intronic
1077350432 11:2090709-2090731 GGCTGTCCAGGGCTGAGGGCAGG + Intergenic
1077714602 11:4569014-4569036 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1078541582 11:12217597-12217619 AGCTTTGCAGAGGAGAGGTTAGG + Intronic
1080723779 11:34874789-34874811 GGGTTTCCAGGCTTGAGGGTGGG - Intronic
1083714667 11:64568511-64568533 GGCTGCCCAGGGCTGGGGTTGGG - Intronic
1085032507 11:73281341-73281363 GGCTTTCCCAGGGTGGGCTTGGG - Intronic
1085767742 11:79298121-79298143 GCCTTTCCAGGTGTGTGGTCAGG + Intronic
1087188048 11:95223156-95223178 GGGTTTGCGGGGGTGGGGTTGGG - Intronic
1088378064 11:109163270-109163292 GCCTGTCAGGGGGTGAGGTTGGG - Intergenic
1088450570 11:109977458-109977480 GGGTTTCCAGGCTTGAAGTTGGG - Intergenic
1089572147 11:119418095-119418117 GGGTCTCCACGGGTGAGGCTGGG - Exonic
1089768955 11:120788891-120788913 GCCCTTCCAGGGGAGAGGTTAGG - Intronic
1090178921 11:124676311-124676333 GGCTTTCCAGGGGTTGGGGCAGG - Intronic
1090705749 11:129334904-129334926 GCCTGTCCAGGGGTGGGGTCAGG - Intergenic
1090879882 11:130824171-130824193 CCCTTACCTGGGGTGAGGTTGGG + Intergenic
1093044231 12:14424077-14424099 TGTTTTCCAAAGGTGAGGTTGGG - Exonic
1093525179 12:20096989-20097011 GGACTTTCAGGGGAGAGGTTCGG + Intergenic
1093749290 12:22779843-22779865 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
1094745656 12:33341512-33341534 GGGTTTCCAGGTTTGAGGGTGGG + Intergenic
1095575338 12:43731417-43731439 GGGTTGCCAGGGGTGAGGGATGG + Intronic
1098100089 12:67006025-67006047 GGCTTTTCAAAGGTGAGGATTGG + Intergenic
1098809207 12:75063478-75063500 GGCTTTTCCGGGGTGAGATAAGG - Intronic
1099335204 12:81347570-81347592 GGGCTTCGAGGGGTGAGCTTTGG + Exonic
1102774678 12:115508177-115508199 AGCTTCCCAGGGGTGAGGTCTGG + Intergenic
1103982616 12:124746313-124746335 GGCTTCCCATGGGGGAGGCTGGG - Intergenic
1105935180 13:25091796-25091818 GGCTTTCCAAGATTGAGCTTAGG - Intergenic
1106076650 13:26466212-26466234 GGCTTCCCTGGGGTGGGGATGGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1108104901 13:46998139-46998161 GGGTTTCCAGGTTTGAGGATGGG + Intergenic
1108467274 13:50728923-50728945 CCCTTTACAGGGGTGAGGTTTGG + Intronic
1108555320 13:51585157-51585179 GGCTTTGCAGGTGTGTGCTTGGG + Intronic
1109842133 13:67932690-67932712 TTCTTTCCAAGGGTGAGTTTGGG - Intergenic
1110542719 13:76723831-76723853 TGCTTTCCTGGGGTGAGTGTAGG - Intergenic
1112558655 13:100492603-100492625 GGATTTCCAGGCTTGAGGGTGGG - Intronic
1115858756 14:37660380-37660402 GCCTGTCCAGGGGTGAGGTGTGG - Intronic
1117739914 14:58806576-58806598 TGCTTTCCAGGGGTAAGATCTGG + Intergenic
1118645476 14:67834379-67834401 GGATATCCAGGGGTGGGGGTGGG + Intronic
1120112228 14:80570770-80570792 GGTTTTCCATGGTAGAGGTTAGG + Intronic
1121159617 14:91725786-91725808 GGGTTTCCAGGCTTGAGGATGGG - Intronic
1121177577 14:91902477-91902499 GAATTTCCAGGGCTGAGGCTTGG + Intronic
1121621861 14:95355861-95355883 GGGGTGCCAGGGGTGATGTTAGG - Intergenic
1121622690 14:95361226-95361248 GTCTTTCCAGGTGGGAAGTTTGG - Intergenic
1122098103 14:99386324-99386346 GGCTTTACAGGGGTGGGGAGAGG + Intergenic
1122630534 14:103105661-103105683 GGCTTTGCTGGGGTGAGGTCTGG + Intronic
1122633948 14:103121745-103121767 GGCTTTGCAGGGCTGAGGCGGGG - Intergenic
1122794377 14:104198655-104198677 GGCCTCCCAGGGGAGAGGATGGG - Intergenic
1123033963 14:105464267-105464289 TGCGTCCCAGGGGTGTGGTTGGG + Intronic
1124037005 15:26063040-26063062 GGCTTACAAGGGGTGAGGCTGGG + Intergenic
1127257812 15:57306644-57306666 GGCTTTTCAGAGGTGGGGTGCGG + Intergenic
1128250964 15:66164084-66164106 GGATTTGCAGGGGTGGGGTGGGG + Intronic
1128294187 15:66503916-66503938 GTCTTTCCACTGGTGAGCTTTGG - Intronic
1128552920 15:68609755-68609777 GGCTCTCCAGGGGTGAGCTGGGG + Intronic
1129956146 15:79638434-79638456 TGCTTTGCAGGGGTGGGGGTTGG - Intergenic
1131365743 15:91837678-91837700 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
1132093016 15:98960851-98960873 GGCTTTCCAGCCGGAAGGTTTGG - Exonic
1133622626 16:7541062-7541084 GGATTTCCAGGTGTGTGGTTAGG - Intronic
1137586783 16:49668575-49668597 GGCATACCAGGGGTCAGCTTGGG - Intronic
1137626212 16:49910382-49910404 GGCTGGCCAGTGGTGGGGTTAGG + Intergenic
1138143907 16:54591858-54591880 GACTTTTGAGGGCTGAGGTTTGG + Intergenic
1138607130 16:58096671-58096693 AGGCTTGCAGGGGTGAGGTTGGG - Intergenic
1138938253 16:61757700-61757722 GCCTTTCCAAGGGAGAGTTTGGG - Intronic
1139519415 16:67472051-67472073 GGCTAGGCAGGGGGGAGGTTTGG - Intronic
1143128899 17:4663647-4663669 GGCTTGCAAGGGGTGAAGTGGGG + Intergenic
1143430029 17:6874837-6874859 GGCTTTGCAGTGGTGAGAATGGG + Intergenic
1143742437 17:8964618-8964640 GGCTTTCCAGGGATGGGATCTGG - Intronic
1143898557 17:10156198-10156220 GGCTCCCCAGGGTAGAGGTTTGG - Intronic
1144845754 17:18218009-18218031 GGCTTTTCAGGGGTGCCTTTGGG + Intergenic
1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG + Intergenic
1147978967 17:44263088-44263110 GGATTTGCAGGTGTGAGGGTAGG + Intronic
1148506072 17:48128031-48128053 GGCTTTCCTGGTATGAGGCTTGG - Intergenic
1149011365 17:51860132-51860154 GGGTTTCCAGGAATGAGATTTGG - Intronic
1149771663 17:59327310-59327332 GACTTTACTGGAGTGAGGTTTGG + Intergenic
1150157547 17:62866823-62866845 GGCTGCTCAGGGGTGAGGGTGGG - Intergenic
1151989136 17:77563058-77563080 AGCTCTCCAGGCGTGAGGCTGGG - Intergenic
1152354350 17:79799403-79799425 AGCTTGCCAGGGGTGGGGGTAGG - Intronic
1152582668 17:81173503-81173525 GGCTTTCCAGCTGTGAGCTTGGG - Intergenic
1155401210 18:25441626-25441648 GGCTTTCCATGGGCAAGGTCAGG - Intergenic
1157245698 18:46052451-46052473 GCCTTTACAGGGTTGTGGTTAGG - Intronic
1158057955 18:53304238-53304260 GGGTTTCCAGGCTTGAGGGTGGG + Intronic
1159702843 18:71650853-71650875 GCCTTCCCAGCGGTGAGGATGGG - Intergenic
1160037008 18:75310637-75310659 GGACTTCCAGGGGTGGGGTTTGG - Intergenic
1161973688 19:7597084-7597106 GGCTTTCCAGCGGGGAGCTGTGG + Intronic
1163373156 19:16913919-16913941 GGCTTTCCTGGGGTGGGGGATGG - Intronic
1163551013 19:17966614-17966636 GGCCTTCCAGGGGTGGGACTGGG - Intronic
1163773694 19:19205731-19205753 TTCCTTCCGGGGGTGAGGTTGGG - Intergenic
1164728868 19:30486251-30486273 GGCTTGTCAGCGGGGAGGTTGGG - Intronic
1164775863 19:30853119-30853141 GGCTTTATAGGGGGGAAGTTAGG - Intergenic
1165601485 19:37058537-37058559 GGCTGTGGAGGGGTGAGGGTGGG + Intronic
1166073038 19:40397701-40397723 GGCTTTCCTGGGGGGAGGAGCGG + Exonic
1166978994 19:46621747-46621769 TGCTTACCAGGGATGAGGTAGGG + Intronic
1168155952 19:54473021-54473043 GGCTTGCCAGGGGTGGGGCCTGG - Intronic
925243946 2:2362413-2362435 TGGTTTCCAAGGGTGAGGTTAGG + Intergenic
926170905 2:10552064-10552086 GGCTTCCCATGGGTGGGCTTCGG + Intergenic
927703839 2:25285221-25285243 GGCTTTGCAGGGGAGGGGCTGGG - Intronic
929963785 2:46518330-46518352 CACTTTCCAGGGGTGGGGGTAGG + Intronic
931109659 2:59097056-59097078 GAATGTCCAGGGGTGAGGTGGGG - Intergenic
932722274 2:74146981-74147003 GGATTGCCAGGAGTGAGGGTGGG + Intronic
932903268 2:75724194-75724216 GCCTGTCCAGGGGTGGGGTGGGG + Intergenic
933437297 2:82263568-82263590 GGGTTTCCAGGTTTGAGGGTGGG + Intergenic
934560573 2:95311092-95311114 GGCTTGCCATGGGTGATATTTGG + Intronic
935708914 2:105880481-105880503 TGCTGCCCAGGGGTGAGGGTGGG + Intronic
935894421 2:107719513-107719535 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
936488792 2:112951838-112951860 GGCCTGTCAGGGGTGAGGTGGGG - Intergenic
937237790 2:120441349-120441371 GGGTTCCCAGGAGAGAGGTTGGG - Intergenic
937278163 2:120699609-120699631 AGCTTGACAAGGGTGAGGTTTGG - Intergenic
937432023 2:121846706-121846728 CGTTTCCCAGGGGTGAGGATGGG + Intergenic
937613458 2:123892420-123892442 GGCTTTCCAGGGGAGTGACTTGG + Intergenic
937639350 2:124193891-124193913 GTCTGTCCAGGGCTGAGGTTTGG - Intronic
939384220 2:141475525-141475547 GGGTTTCCAGGCTTGAGGATGGG - Intronic
940196475 2:151100609-151100631 TGGTTGCCAGGGGTTAGGTTTGG + Intergenic
940660061 2:156534425-156534447 GGGTTTCCAGGCTTGAGGGTGGG + Intronic
942173295 2:173308085-173308107 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
943566124 2:189519190-189519212 GGCTTTCCAGGGCAAAGGTAGGG - Intergenic
944495388 2:200302636-200302658 GGCTTTCCACGGATGAGGCCTGG + Intergenic
945339812 2:208639567-208639589 GGGTTTCCAGGCTTGAGGGTGGG - Intronic
947129116 2:226903697-226903719 GGGTTTCCAGGCTTGAGGGTGGG - Intronic
948430289 2:237914227-237914249 GGCTTTCTAGGGGAGAAGTGGGG - Intergenic
1168737886 20:159448-159470 GGATTTCCATGGATGAGGTTTGG + Intergenic
1168869385 20:1115542-1115564 GGCTTTCAAGGGGTGGGCATGGG - Intronic
1169255338 20:4092405-4092427 GGCTTTACTGGGGGGATGTTTGG + Intergenic
1171211620 20:23321306-23321328 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
1173046688 20:39519313-39519335 GGCTCTCCAGCGGTGAATTTTGG + Intergenic
1173369874 20:42426127-42426149 GGGTTTCCAGGCTTGAGGGTGGG - Intronic
1175915257 20:62423017-62423039 GGCTTTCCTGGTGGGAGGCTGGG + Intronic
1178164910 21:29962307-29962329 GGGTTTCCAGGCTTGGGGTTGGG + Intergenic
1178222364 21:30674864-30674886 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1178267564 21:31158209-31158231 GGCTGTCTGAGGGTGAGGTTGGG - Intronic
1179554218 21:42162338-42162360 GGCTGTGCAGGGGTGAGTTGGGG + Intergenic
1179554234 21:42162406-42162428 GGCTGTGCAGGGGTGAGCTGGGG + Intergenic
1181261749 22:21602982-21603004 GGCTTCCCAGGGTTGGTGTTAGG + Intronic
1181805805 22:25373823-25373845 TTCTTTCCAGGTGTCAGGTTCGG - Intronic
1181975581 22:26726990-26727012 GATTTTCCAGGGGTGGGGTGAGG + Intergenic
1182334029 22:29571111-29571133 GGCTTTCCATGTGTGGGGTCAGG - Intronic
1182631947 22:31693028-31693050 GGCTGTCCATGTGTGAGGGTAGG - Intronic
1183341889 22:37286092-37286114 GGCTTTGCAGGGGTTGGGTGGGG + Intronic
1183492225 22:38122781-38122803 TGCTTTGCAGGGGTGAGGGGAGG + Intronic
1184649715 22:45914002-45914024 GGTGTTCCAGGGGTAAGGCTGGG - Intergenic
1185046420 22:48530783-48530805 GAGTTCCCAGGAGTGAGGTTTGG + Intronic
953369618 3:42376319-42376341 GGCTTCCCAGGGCAGAGGGTGGG - Intergenic
956461088 3:69473257-69473279 GGCTTGACAAGGGTGAGGTCAGG + Intronic
956890338 3:73607103-73607125 GGTTTTGCAGGGGTGGGGATTGG - Intronic
957950010 3:87112325-87112347 GGTTTTCCAGGCTTGAGGATGGG + Intergenic
957984919 3:87562184-87562206 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
958023728 3:88026574-88026596 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
958442714 3:94175891-94175913 TGGTTGCCAGGGGTGAGGGTAGG - Intergenic
959204303 3:103284819-103284841 GGGTTTCCAGGATTGAGGGTGGG + Intergenic
959548155 3:107622104-107622126 GGGTTGCCAGGGGTTAGGGTTGG - Intronic
961537506 3:127578998-127579020 GGCTGTCCAGGTGTGGGCTTCGG - Intronic
963027463 3:140933792-140933814 GGCTTTCCAGCGCTGTGGTGGGG - Intergenic
963441853 3:145350072-145350094 GACTTTCCATGTGTGAGATTAGG - Intergenic
964869372 3:161296526-161296548 GGCTTTCCAGGGGGGAATTTGGG + Intergenic
965954447 3:174351857-174351879 GGCTTTCCAGGGGTTTGGTAGGG - Intergenic
968234095 3:197021578-197021600 GGCTTTCCAGTTGTGTGGTCTGG + Intronic
968432523 4:567136-567158 GGCTGACCAGGGGTTAGGCTGGG + Intergenic
968953424 4:3706394-3706416 GGCCTTCCAGGGGTCAGGGTGGG + Intergenic
969517684 4:7656695-7656717 GGCTTTCCCTGGGTGAGCGTGGG - Intronic
970858941 4:20679702-20679724 GTGTTTCCAGTTGTGAGGTTGGG + Intergenic
971116504 4:23652618-23652640 GGCTTTACAGGGGAGAATTTGGG - Intergenic
971279782 4:25233866-25233888 GGCTTTTGAGGGGTCAGGTGGGG - Intronic
971742734 4:30540439-30540461 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
973598126 4:52513370-52513392 TGCTTTGCCTGGGTGAGGTTTGG - Intergenic
974368692 4:60985991-60986013 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
975004795 4:69271222-69271244 GGCTTGCCTGTGGTGAGATTGGG - Intergenic
975060149 4:69986490-69986512 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
975580856 4:75906067-75906089 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
976072143 4:81253823-81253845 GGCTGCCCTGGGGTGAGGCTGGG - Intergenic
979503509 4:121467334-121467356 GCCTGTCCAGGGGTGTGGTGGGG - Intergenic
980006092 4:127544266-127544288 GGTTTTCCAGGCTTGAGGGTGGG - Intergenic
980096992 4:128501616-128501638 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
980871411 4:138615476-138615498 GGGTTTCCAGGGTTCAGGTGGGG - Intergenic
981757351 4:148154806-148154828 GGCTTTGCGGGGGTGGGGGTGGG + Exonic
984099748 4:175471347-175471369 TGGTTACCAGGGTTGAGGTTAGG - Intergenic
986167095 5:5283468-5283490 GGCTTTCTGGGGGGGAGGTGGGG - Intronic
986542663 5:8863616-8863638 GGGTTTCCAGGCTTGAGGGTAGG - Intergenic
986728515 5:10617912-10617934 GGCTTGGCAGAGGTGATGTTGGG - Intronic
987298843 5:16578820-16578842 GGCTTTGCAGGGGGAAGGCTGGG - Intronic
987628529 5:20435460-20435482 GGGTTTGCAGGCCTGAGGTTGGG - Intronic
988571476 5:32371499-32371521 GGCTCTCCAGAGATGAGGGTGGG + Intronic
988849771 5:35168946-35168968 TGCTTTCCAGGTTTGAGGTGTGG - Intronic
990487875 5:56277079-56277101 GGCCTTCAAGGGATGAGGTGAGG - Intergenic
991645043 5:68792971-68792993 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
992474564 5:77088849-77088871 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
994209551 5:97072992-97073014 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
995226558 5:109707634-109707656 GGCTATGCAGAGGTGACGTTTGG + Intronic
996671592 5:126123693-126123715 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
997183199 5:131854316-131854338 TGGTTTCCAGGGGTGGGGTAGGG + Intronic
997208995 5:132066730-132066752 GGCTTTCAAGGGGGAAAGTTGGG - Intergenic
998401809 5:141852327-141852349 GGCTTTTCCGGGGTGGGGGTGGG + Intergenic
998750801 5:145319185-145319207 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
998910436 5:146954184-146954206 CACCTTCCAGGAGTGAGGTTCGG - Intronic
999258694 5:150224350-150224372 GGCTCTCTAAGGGTGGGGTTGGG - Intronic
999359484 5:150970948-150970970 GGCTTTTGAGGGGTGAGTTGGGG + Intergenic
999579304 5:153017949-153017971 GGTTTTCCTGGGGTGGGGGTGGG - Intergenic
999671195 5:153960423-153960445 GGCTGTGCAGGGCTGAGGATAGG - Intergenic
1000201972 5:159020141-159020163 TGGTTTGCAGGGGTGAGGTAAGG - Intronic
1000244097 5:159434626-159434648 GGCTTTGCAGGGGTGGGATGGGG + Intergenic
1000596618 5:163221811-163221833 GGCTTTCTAGGGGTAACCTTGGG - Intergenic
1001249263 5:170133763-170133785 GGCTTGGCAGGGGAGAGGTCAGG + Intergenic
1002692318 5:181059092-181059114 GGGTTTGCAGGGGTGAGGGTCGG + Intronic
1003117659 6:3293946-3293968 GGCTTCTCCGGGGTGAGGTGTGG + Intronic
1004913875 6:20313270-20313292 GGCTTTCCAGGGGGTGGGTCTGG - Intergenic
1005573721 6:27172395-27172417 ATCTTTCCAGGGTTGAGGTTGGG - Intergenic
1006598633 6:35211750-35211772 GGCTTTCAGGGAGGGAGGTTTGG - Intergenic
1009038464 6:58147496-58147518 GGCCTGTCAGGGGTGGGGTTGGG - Intergenic
1009214254 6:60901148-60901170 GGCCTGTCAGGGGTGGGGTTGGG - Intergenic
1009404144 6:63291683-63291705 GGGTTTCCAGGCTTGAGGGTGGG + Intronic
1011491887 6:87901039-87901061 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
1012798520 6:103794949-103794971 GCCTGTTCAGGGGTGAGGGTTGG + Intergenic
1013057676 6:106600190-106600212 TACTTTCCAGGAGGGAGGTTTGG - Intronic
1014046809 6:116898216-116898238 GCCTTTCCAGTGGTGAGCTGGGG + Intronic
1015042816 6:128742536-128742558 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1015997514 6:139009537-139009559 GGGGTTACAGGTGTGAGGTTAGG + Intergenic
1018663060 6:166106066-166106088 GCCTTCCCAGGAGTGGGGTTGGG - Intergenic
1018915895 6:168132173-168132195 GGCTTTCCAGGTGGGGGGATGGG - Intergenic
1019158846 6:170056396-170056418 GGTTGTGCAGGGGTGAGGCTGGG + Intergenic
1022807208 7:33834332-33834354 AGTGATCCAGGGGTGAGGTTAGG + Intergenic
1023315257 7:38929461-38929483 GGCTGTCCAAGGGTGAGTATGGG - Intronic
1023631849 7:42172918-42172940 TGCTTCCCAGGGATGGGGTTTGG - Intronic
1023754281 7:43401771-43401793 GGGTTTCCAGGATTGAGGGTGGG - Intronic
1025601556 7:63003428-63003450 GGTTTTCTAGTGGTGATGTTGGG + Intergenic
1025985809 7:66450677-66450699 GGCTTTACAACGGTGATGTTTGG + Intergenic
1026002665 7:66573990-66574012 GGCTTTACAACGGTGATGTTTGG + Intergenic
1026029193 7:66774805-66774827 GGCTTTACAACGGTGATGTTTGG - Intronic
1027513855 7:79116582-79116604 GGTATTCCAGGGATGTGGTTTGG + Intronic
1027585284 7:80049513-80049535 AGGTTTCCAGGCTTGAGGTTGGG + Intergenic
1027888261 7:83937520-83937542 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1028530449 7:91832322-91832344 GGGTTTCCAGGCTTGAGGGTGGG + Intronic
1029016066 7:97316482-97316504 GGTTTTCCAGGCTTGAGGGTGGG - Intergenic
1029017111 7:97326098-97326120 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic
1029516388 7:101026097-101026119 AGCTTTGCAGGGGTGAGTATAGG - Intronic
1030386503 7:108873939-108873961 GGGTTTCCAGGCTTGAGGGTAGG - Intergenic
1030418047 7:109270199-109270221 TGGTTTCCAGGGGTAAGGTTTGG - Intergenic
1034239608 7:149599730-149599752 GGCTCTCAAGGGGTGTGGTGAGG + Intergenic
1034483417 7:151341304-151341326 GGCTTCCCTGGGGTGAAATTAGG - Intergenic
1035079156 7:156201983-156202005 GTCTCTCCAGAGGTGAGGCTGGG - Intergenic
1037660499 8:20922301-20922323 GCCTTACCAGGGGTAAGTTTGGG - Intergenic
1037833360 8:22201749-22201771 GTCTGTGCAGGGCTGAGGTTGGG - Intronic
1037941366 8:22953412-22953434 GACATTCCTGGGGTGGGGTTGGG + Intronic
1038249214 8:25887250-25887272 AGGATTCCAGGGGTGAGGGTGGG - Intronic
1039928394 8:41960129-41960151 TGCTTACCAGGGGTGGGGGTAGG + Intronic
1041109957 8:54474910-54474932 GGTTTTTCTGGGTTGAGGTTGGG + Intergenic
1041216617 8:55607565-55607587 GGGTTTCCAGGCTTGAGGGTAGG - Intergenic
1043701950 8:83300516-83300538 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1043880873 8:85541051-85541073 GACTTTCTAGGGGTAAGGCTAGG + Intergenic
1046567204 8:115917361-115917383 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1046582473 8:116110557-116110579 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1047235217 8:123035475-123035497 GGCTTTCCAGGGTTGAAAATGGG - Intronic
1047443102 8:124896580-124896602 ATCTTTCAAGGGGTGAGGTCTGG + Intergenic
1048488411 8:134869634-134869656 GGCTTTCCAGGTAAGAGGTAAGG + Intergenic
1049434860 8:142581804-142581826 GGGATTCCCGAGGTGAGGTTTGG + Intergenic
1050981233 9:12018283-12018305 GGGTTTCCAGGTTTGAGGGTGGG + Intergenic
1051706831 9:19889543-19889565 GTCTTTTCAGGGGTGAGGGATGG + Intergenic
1052793601 9:32901988-32902010 GGCTTTCCAGGCATGGGGGTGGG - Intergenic
1052999710 9:34571269-34571291 GACTGGCCAGGGCTGAGGTTGGG - Intronic
1053289877 9:36872872-36872894 AGGTTTCCAGGGCTGAGGTGTGG + Intronic
1055486230 9:76759320-76759342 GGGTTTCCAGGATTGAGGGTGGG - Intronic
1055673558 9:78631963-78631985 GGGGTTCCAGGGGTGAGGGATGG + Intergenic
1056537776 9:87546098-87546120 AGCTTTCCTGTGGTGAGATTGGG + Intronic
1056574548 9:87844969-87844991 GGCTTTCCTGGGGTGATGGGAGG - Intergenic
1056993982 9:91437671-91437693 TGCTTACCAGGGGTGGGGCTAGG - Intergenic
1058781271 9:108337858-108337880 GGTTTTCAAGAGGTGAGGTCAGG - Intergenic
1059628463 9:116092788-116092810 AGTTTTCTAGGGGAGAGGTTGGG + Intergenic
1059799169 9:117732173-117732195 AGCTCTCCAGGGGTGAGATGGGG + Intergenic
1059971446 9:119672958-119672980 GGCCTGTCAGGGGTGGGGTTGGG - Intergenic
1061264195 9:129496203-129496225 GCCTCTGCAGGGGTAAGGTTGGG - Intergenic
1062550069 9:137082090-137082112 GGCTTTTCTGGTGTCAGGTTTGG + Intronic
1185738558 X:2512046-2512068 GGGTTTCCAGGCGTGAGGGTGGG + Intergenic
1185802999 X:3030217-3030239 GGCTTTCCAAGGGAAAGGTCAGG + Intronic
1186031696 X:5375865-5375887 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1186403238 X:9278691-9278713 GGCTTTCCAAGGAAAAGGTTTGG + Intergenic
1187114280 X:16333181-16333203 GCATTTCCAAGGATGAGGTTTGG + Intergenic
1187986359 X:24816717-24816739 GGGCTTCCAGGGATGAGTTTGGG + Intronic
1190316675 X:49156271-49156293 GGCCTCCCAGGGGGCAGGTTCGG - Intergenic
1190335361 X:49258480-49258502 GGCTTGCCAGGCCTGGGGTTGGG + Exonic
1192285134 X:69727353-69727375 GGATTTCCAGGCTTGAGGATGGG + Intronic
1193032241 X:76911338-76911360 GGGTCTCTGGGGGTGAGGTTGGG - Intergenic
1194163421 X:90483723-90483745 GGCTTTCCAGGCTTGAGGGTGGG + Intergenic
1194434722 X:93856056-93856078 GGCTTCCCATGGCTGGGGTTTGG + Intergenic
1194591390 X:95804467-95804489 GTCTTTGCAGGGGGGAGGATTGG - Intergenic
1196375098 X:115025230-115025252 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1198285006 X:135180652-135180674 GGCTCTCCAGGGATGAGGCATGG + Intergenic
1199380603 X:147168201-147168223 GGGTTTCCAGGCTTGAGGGTGGG - Intergenic
1201751544 Y:17436919-17436941 GGGTTTCCAGGCTTGAGGGTGGG + Intergenic