ID: 920079389

View in Genome Browser
Species Human (GRCh38)
Location 1:203361300-203361322
Sequence CTTCCACTTACTTAAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920079389_920079393 -5 Left 920079389 1:203361300-203361322 CCAGCATTTTAAGTAAGTGGAAG No data
Right 920079393 1:203361318-203361340 GGAAGAAGTGACTGGGGTGCAGG No data
920079389_920079394 -4 Left 920079389 1:203361300-203361322 CCAGCATTTTAAGTAAGTGGAAG No data
Right 920079394 1:203361319-203361341 GAAGAAGTGACTGGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920079389 Original CRISPR CTTCCACTTACTTAAAATGC TGG (reversed) Intergenic
No off target data available for this crispr