ID: 920085050

View in Genome Browser
Species Human (GRCh38)
Location 1:203409222-203409244
Sequence AACCCAGCTGTGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920085050_920085058 24 Left 920085050 1:203409222-203409244 CCAGGCAGAGGCACAGCTGGGTT No data
Right 920085058 1:203409269-203409291 TATATATGCTCAGAATGCGTTGG No data
920085050_920085056 -8 Left 920085050 1:203409222-203409244 CCAGGCAGAGGCACAGCTGGGTT No data
Right 920085056 1:203409237-203409259 GCTGGGTTTGGGGGGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920085050 Original CRISPR AACCCAGCTGTGCCTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr