ID: 920087174

View in Genome Browser
Species Human (GRCh38)
Location 1:203426112-203426134
Sequence GTGAAGAAACAGATTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920087174_920087177 30 Left 920087174 1:203426112-203426134 CCTCTCTGAATCTGTTTCTTCAC No data
Right 920087177 1:203426165-203426187 CATTTTTTGTTAACATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920087174 Original CRISPR GTGAAGAAACAGATTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr