ID: 920087820

View in Genome Browser
Species Human (GRCh38)
Location 1:203430662-203430684
Sequence TCCCCACTGGAGTCACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920087812_920087820 -2 Left 920087812 1:203430641-203430663 CCCACCCAGTGGCCTTGGGTCTC No data
Right 920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG No data
920087814_920087820 -6 Left 920087814 1:203430645-203430667 CCCAGTGGCCTTGGGTCTCCCCA No data
Right 920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG No data
920087813_920087820 -3 Left 920087813 1:203430642-203430664 CCACCCAGTGGCCTTGGGTCTCC No data
Right 920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG No data
920087811_920087820 1 Left 920087811 1:203430638-203430660 CCTCCCACCCAGTGGCCTTGGGT No data
Right 920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG No data
920087815_920087820 -7 Left 920087815 1:203430646-203430668 CCAGTGGCCTTGGGTCTCCCCAC No data
Right 920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920087820 Original CRISPR TCCCCACTGGAGTCACAGGG AGG Intergenic
No off target data available for this crispr