ID: 920087882

View in Genome Browser
Species Human (GRCh38)
Location 1:203431146-203431168
Sequence ACTGATAAGCATCAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920087874_920087882 30 Left 920087874 1:203431093-203431115 CCTTTCCCAGTACACTATGATTT No data
Right 920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG No data
920087875_920087882 25 Left 920087875 1:203431098-203431120 CCCAGTACACTATGATTTCTAGG No data
Right 920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG No data
920087879_920087882 2 Left 920087879 1:203431121-203431143 CCTTTCACCATGCTGGTTACTCT No data
Right 920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG No data
920087877_920087882 24 Left 920087877 1:203431099-203431121 CCAGTACACTATGATTTCTAGGC No data
Right 920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG No data
920087880_920087882 -5 Left 920087880 1:203431128-203431150 CCATGCTGGTTACTCTCTACTGA No data
Right 920087882 1:203431146-203431168 ACTGATAAGCATCAGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920087882 Original CRISPR ACTGATAAGCATCAGTTGCA GGG Intergenic
No off target data available for this crispr